Morpholino

MO1-wwtr1

ID
ZDB-MRPHLNO-051101-2
Name
MO1-wwtr1
Previous Names
  • Taz MO1 (1)
Target
Sequence
5' - CTGGAGAGGATTACCGCTCATGGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wwtr1
No data available
Phenotype
Phenotype resulting from MO1-wwtr1
Phenotype Fish Figures
aortic arch dysplastic, abnormal WT + MO1-wwtr1 Fig. 7 with image from Pappalardo et al., 2015
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-wwtr1 Figure 1 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-wwtr1 Figure 1 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO1-wwtr1 Figure 1 with image from Fillatre et al., 2019
pharyngeal vasculature morphology, abnormal WT + MO1-wwtr1 Fig. 7 with image from Pappalardo et al., 2015
posterior kidney cystic, abnormal WT + MO1-wwtr1 Fig. 3 from Tian et al., 2007
pronephric distal early tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric distal late tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with image from Zhang et al., 2015
pronephric duct malformed, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 2 with image from Zhang et al., 2015
pronephric duct single ciliated epithelial cell decreased amount, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with image from Zhang et al., 2015
pronephric proximal convoluted tubule dilated, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule increased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal WT + MO1-wwtr1 + MO4-tp53 Fig. 1 with image from Zhang et al., 2015
pronephric proximal convoluted tubule straight, abnormal WT + MO1-wwtr1 + MO4-tp53 Fig. 1 with image from Zhang et al., 2015
pronephric proximal straight tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal tubule development process quality, abnormal WT + MO1-wwtr1 + MO4-tp53 Fig. 1 with image from Zhang et al., 2015
pronephric tubule orientation whole organism anterior-posterior axis, abnormal WT + MO1-wwtr1 + MO4-tp53 Fig. 1 with image from Zhang et al., 2015
rhombomere 1 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 Figure 5 with image from Cayuso et al., 2019
thyroid follicle decreased amount, abnormal WT + MO1-wwtr1 Fig. 5 with imageFig. 6 with image from Pappalardo et al., 2015
thyroid follicle decreased diameter, abnormal WT + MO1-wwtr1 Table 1 from Pappalardo et al., 2015
thyroid follicle ab-t4 labeling spatial pattern, abnormal WT + MO1-wwtr1 Fig. 5 with image from Pappalardo et al., 2015
thyroid follicle spatial pattern, abnormal WT + MO1-wwtr1 Fig. 5 with image from Pappalardo et al., 2015
thyroid primordium tg expression increased amount, abnormal WT + MO1-wwtr1 Fig. 3 with image from Pappalardo et al., 2015
trunk decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 Fig. 2 with image from Zhang et al., 2015
whole organism curved ventral, abnormal WT + MO1-wwtr1 Fig. 3 from Tian et al., 2007
whole organism pax2a expression decreased amount, abnormal WT + MO1-wwtr1 Fig. 4 from Pappalardo et al., 2015
whole organism tshr expression decreased amount, abnormal WT + MO1-wwtr1 Fig. 4 from Pappalardo et al., 2015
whole organism tg expression increased amount, abnormal WT + MO1-wwtr1 Fig. 4 from Pappalardo et al., 2015
whole organism slc5a5 expression increased amount, abnormal WT + MO1-wwtr1 Fig. 4 from Pappalardo et al., 2015
whole organism tpo expression increased amount, abnormal WT + MO1-wwtr1 Fig. 4 from Pappalardo et al., 2015
Phenotype of all Fish created by or utilizing MO1-wwtr1
Phenotype Fish Conditions Figures
heart tube mislocalised, abnormal AB/TU + MO1-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
rhombomere 3 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
thyroid follicle ab-t4 labeling spatial pattern, abnormal WT + MO1-wwtr1 standard conditions Fig. 5 with image from Pappalardo et al., 2015
rhombomere 4 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
whole organism tpo expression increased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 4 from Pappalardo et al., 2015
whole organism slc5a5 expression increased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 4 from Pappalardo et al., 2015
whole organism pax2a expression decreased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 4 from Pappalardo et al., 2015
thyroid primordium tg expression increased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 3 with image from Pappalardo et al., 2015
rhombomere 5 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
posterior kidney cystic, abnormal WT + MO1-wwtr1 standard conditions Fig. 3 from Tian et al., 2007
whole organism tg expression increased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 4 from Pappalardo et al., 2015
thyroid follicle decreased diameter, abnormal WT + MO1-wwtr1 standard conditions Table 1 from Pappalardo et al., 2015
rhombomere 6 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
aortic arch dysplastic, abnormal WT + MO1-wwtr1 standard conditions Fig. 7 with image from Pappalardo et al., 2015
whole organism curved ventral, abnormal WT + MO1-wwtr1 standard conditions Fig. 3 from Tian et al., 2007
thyroid follicle spatial pattern, abnormal WT + MO1-wwtr1 standard conditions Fig. 5 with image from Pappalardo et al., 2015
thyroid follicle decreased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 5 with imageFig. 6 with image from Pappalardo et al., 2015
rhombomere 1 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
whole organism tshr expression decreased amount, abnormal WT + MO1-wwtr1 standard conditions Fig. 4 from Pappalardo et al., 2015
pharyngeal vasculature morphology, abnormal WT + MO1-wwtr1 standard conditions Fig. 7 with image from Pappalardo et al., 2015
rhombomere 2 posterior margin rfng expression absent, abnormal WT + MO1-wwtr1 standard conditions Figure 5 with image from Cayuso et al., 2019
pronephric proximal convoluted tubule straight, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric tubule orientation whole organism anterior-posterior axis, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric proximal tubule development process quality, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric distal early tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 control Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule dilated, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 control Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric duct malformed, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 2 with image from Zhang et al., 2015
pronephric distal early tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule increased length, exacerbated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric distal late tubule increased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule dilated, exacerbated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule increased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 control Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule size, ameliorated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
pronephric distal late tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2015
pronephric duct single ciliated epithelial cell decreased amount, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2015
pronephric proximal straight tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 control Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
trunk decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 2 with image from Zhang et al., 2015
post-vent region curved, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton morphology, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton bone mineralization decreased occurrence, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
Citations