Morpholino

MO1-ptgs1

ID
ZDB-MRPHLNO-050722-3
Name
MO1-ptgs1
Previous Names
  • cox1-MO (1)
  • MORPH1203 (1)
  • zCOX-1-A (1)
Target
Sequence
5' - TCAGCAAAAAGTTACACTCTCTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed against translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptgs1
Phenotype
Phenotype resulting from MO1-ptgs1
Phenotype Fish Figures
brain hydrocephalic, abnormal TU + MO1-ptgs1 Fig. S3 from Marra et al., 2019
Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-ptgs1 Fig. 5 with image from Grosser et al., 2002
heart bilateral symmetry, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
pericardium edematous, abnormal TU + MO1-ptgs1 Fig. S3 from Marra et al., 2019
post-vent region curved ventral, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 2 from Marra et al., 2019
pronephric duct odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 1 with image from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 Fig. 1 with imageFig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 Fig. 4 from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 3 from Marra et al., 2019
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ptgs1 Fig. 4 with image from Chambers et al., 2020
trunk curved ventral, abnormal TU + MO1-ptgs1 Fig. 4 with image from Chambers et al., 2020
Fig. 5 from Jin et al., 2014
whole organism viability, abnormal AB + MO1-ptgs1 Fig. 5 with image from Grosser et al., 2002
Phenotype of all Fish created by or utilizing MO1-ptgs1
Phenotype Fish Conditions Figures
whole organism viability, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
pronephric distal late tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 2 from Marra et al., 2019
pronephric distal late tubule decreased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 control Fig. 4 from Marra et al., 2019
pronephric duct odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 1 with image from Marra et al., 2019
trunk curved ventral, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 control Fig. 3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs1 chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs1 control Fig. S3 from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 control Fig. 1 with imageFig. 2 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs1 control Fig. S3 from Marra et al., 2019
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric proximal straight tubule multi-ciliated epithelial cell odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 3 from Marra et al., 2019
pronephric distal early tubule increased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
brain ventricular system edematous, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
brain hydrocephalic, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart bilateral symmetry, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
trunk curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptgs1 + MO2-ptgs1 standard conditions Fig. S1 from North et al., 2007
exocrine pancreas decreased size, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
pronephros has fewer parts of type ciliated epithelial cell ciliary basal body, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium decreased length, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros has number of pronephros multi-ciliated epithelial cell, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
trunk curvature, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
trunk curved ventral, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly process quality, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly decreased process quality, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium length, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 4 from Marra et al., 2019
pronephric duct odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, exacerbated TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pronephric duct odf3b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
brain ventricular system edematous, abnormal WT + MO1-ptgs1 + MO2-ptgs2a standard conditions Fig. 5 from Jin et al., 2014
Citations