ZFIN ID: ZDB-MRPHLNO-050722-3
Morpholino Name: MO1-ptgs1
Target: ptgs1 (2)
Previous Names: cox1-MO (1), MORPH1203 (1), zCOX-1-A (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGCAAAAAGTTACACTCTCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed against translation-start
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ptgs1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ptgs1
Expressed Gene Anatomy Figures
gata1a Fig. 4 from Yeh et al., 2009
mpx Fig. 4 from Yeh et al., 2009
myl7 Fig. 5 from Jin et al., 2014
pax2a Fig. 7 with image from Cha et al., 2005
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
PHENOTYPE
Phenotype resulting from MO1-ptgs1
Phenotype Figures
brain hydrocephalic, abnormal Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal Fig. 5 from Jin et al., 2014
epiboly involved in gastrulation with mouth forming second delayed, abnormal Fig. 5 with image from Grosser et al., 2002
heart bilateral symmetry, abnormal Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal Fig. 5 from Jin et al., 2014
pronephric distal early tubule slc12a1 expression increased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016
trunk curved ventral, abnormal Fig. 5 from Jin et al., 2014
whole organism viability, abnormal Fig. 5 with image from Grosser et al., 2002

Phenotype of all Fish created by or utilizing MO1-ptgs1
Phenotype Fish Conditions Figures
whole organism viability, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
pronephric distal late tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
post-vent region curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
brain hydrocephalic, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart bilateral symmetry, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
trunk curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptgs1 + MO2-ptgs1 standard conditions Fig. S1 from North et al., 2007
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
brain ventricular system edematous, abnormal WT + MO1-ptgs1 + MO2-ptgs2a standard conditions Fig. 5 from Jin et al., 2014
OTHER MO1-ptgs1 MORPHOLINO PAGESNo links to external sites
CITATIONS (10)