ZFIN ID: ZDB-MRPHLNO-050513-12
Morpholino Name: MO1-vegfaa
Target: vegfaa (1)
Previous Names: MO1-vegf, MO1-vegfa, VEGF-A-1 (1), vegfMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTATCAAATAAACAACCAAGTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vegfaa
Expressed Gene Anatomy Figures
etv2 Fig. 7 with image from Sumanas et al., 2006
fli1a Fig. 8 with image from Childs et al., 2002
gata1a Fig. 4 with image from Jing et al., 2013
hsd3b Fig. 6 with image from Liu et al., 2006
kdrl Fig. 4 with image from Jing et al., 2013
Fig. 3 from Leung et al., 2006
mpx Fig. 4 with image from Jing et al., 2013
nr5a1a Fig. 6 with image from Liu et al., 2006
spi1b Fig. 4 with image from Jing et al., 2013
tek Fig. 3 from Li et al., 2014
tie1 Fig. 8 with image from Childs et al., 2002
wt1a Fig. 6 with image from Liu et al., 2006
PHENOTYPE
Phenotype resulting from MO1-vegfaa
Phenotype Figures
angioblast cell migration delayed, abnormal Fig. 8 with image from Childs et al., 2002
angiogenesis disrupted, abnormal Fig. 4 with image from Jing et al., 2013
angiogenesis process quality, abnormal Fig. 2 from Weijts et al., 2012
angiogenic sprout absent, abnormal Fig. 8 with image from Childs et al., 2002
angiogenic sprout physical object quality, abnormal Fig. 2 from Weijts et al., 2012
aortic arch 5 absent, abnormal Fig. 1 from Nicoli et al., 2010
blood circulation arrested, abnormal Fig. 4 from Rottbauer et al., 2005
blood circulation decreased occurrence, abnormal Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal Fig. 6 from Hooper et al., 2009
cardiac ventricle decreased contractility, abnormal Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal Fig. 4 from Rottbauer et al., 2005
caudal vein plexus aplastic, abnormal Fig. 4 from Kawamura et al., 2008
dorsal aorta broken, abnormal Fig. 8 with image from Childs et al., 2002
dorsal longitudinal anastomotic vessel hypoplastic, abnormal Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal Fig. 6 from Hooper et al., 2009
intersegmental artery malformed, abnormal Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal Fig. 2 from Weijts et al., 2012
intersegmental vessel absent, abnormal Fig. 3 with image from Jensen et al., 2015
intersegmental vessel aplastic, abnormal Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal Fig. 3 with image from Stahlhut et al., 2012
intersegmental vessel irregular spatial pattern, abnormal Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal Fig. 3 with image from Jensen et al., 2012
intersegmental vessel truncated, abnormal Fig. 1 from Li et al., 2014
pericardium edematous, abnormal Fig. 4 from Rottbauer et al., 2005
sprouting angiogenesis disrupted, abnormal Fig. 1 from Li et al., 2014
vein broken, abnormal Fig. 8 with image from Childs et al., 2002

Phenotype of all Fish created by or utilizing MO1-vegfaa
Phenotype Fish Conditions Figures
angioblast cell migration delayed, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
blood circulation arrested, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
angiogenesis disrupted, abnormal WT + MO1-vegfaa standard conditions Fig. 4 with image from Jing et al., 2013
angiogenic sprout absent, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
pericardium edematous, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle decreased contractility, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
vein broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
dorsal aorta broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
aortic arch 5 absent, abnormal la116Tg + MO1-vegfaa standard conditions Fig. 1 from Nicoli et al., 2010
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenic sprout physical object quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenesis process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental vessel truncated, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel absent, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
caudal vein plexus aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 4 from Kawamura et al., 2008
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
blood circulation decreased occurrence, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-vegfaa standard conditions Fig. 3 with image from Stahlhut et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-nlgn1 + MO1-vegfaa standard conditions Fig. 4 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-hs6st2 standard conditions Fig. 5 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-nrxn1a standard conditions Fig. 4 from Rissone et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO1-arntl1a + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
blood circulation decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel non-functional, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel increased length, abnormal y1Tg + MO1-per2 + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel morphology, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vein decreased size, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis paedomorphic growth, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenic sprout physical object quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental vessel dorsal region branchiness, ameliorated s843Tg ; flt1ka601/ka601 + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
intersegmental vessel vascular sprouts amount, ameliorated s843Tg ; flt1ka601/ka601 + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
OTHER MO1-vegfaa MORPHOLINO PAGES
  • MODB:10 (2)
  • CITATIONS (42)