Morpholino

MO1-vegfaa

ID
ZDB-MRPHLNO-050513-12
Name
MO1-vegfaa
Previous Names
  • MO1-vegf
  • MO1-vegfa
  • VEGF-A-1 (1)
  • vegfMO (1)
Target
Sequence
5' - GTATCAAATAAACAACCAAGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vegfaa
No data available
Phenotype
Phenotype resulting from MO1-vegfaa
Phenotype Fish Figures
angioblast cell migration delayed, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
angiogenesis disrupted, abnormal WT + MO1-vegfaa Fig. 4 with image from Jing et al., 2013
angiogenesis process quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
angiogenic sprout absent, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
angiogenic sprout physical object quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
aortic arch 5 absent, abnormal la116Tg + MO1-vegfaa Fig. 1 from Nicoli et al., 2010
axial vasculature kdrl expression spatial pattern, abnormal WT + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
blood circulation arrested, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
blood circulation decreased occurrence, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
cardiac ventricle decreased contractility, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
caudal vein plexus aplastic, abnormal y1Tg + MO1-vegfaa Fig. 4 from Kawamura et al., 2008
dorsal aorta broken, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
Fig. 6 from Hooper et al., 2009
intersegmental artery malformed, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
intersegmental vessel absent, abnormal y1Tg + MO1-vegfaa Fig. 3 with image from Jensen et al., 2015
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal y1Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-vegfaa Fig. 3 with image from Stahlhut et al., 2012
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal y1Tg + MO1-vegfaa Fig. 3 with image from Jensen et al., 2012
intersegmental vessel truncated, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
pericardium edematous, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
sprouting angiogenesis delayed, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
vein broken, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
Phenotype of all Fish created by or utilizing MO1-vegfaa
Phenotype Fish Conditions Figures
Muller cell cell population proliferation increased occurrence, ameliorated AB + MO1-vegfaa physical alteration: retina Fig. 1 from Mitra et al., 2022
angioblast cell migration delayed, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
blood circulation arrested, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
angiogenesis disrupted, abnormal WT + MO1-vegfaa standard conditions Fig. 4 with image from Jing et al., 2013
axial vasculature kdrl expression spatial pattern, abnormal WT + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
angiogenic sprout absent, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
pericardium edematous, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle decreased contractility, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
vein broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
dorsal aorta broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
aortic arch 5 absent, abnormal la116Tg + MO1-vegfaa standard conditions Fig. 1 from Nicoli et al., 2010
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental vessel decreased amount, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
angiogenic sprout physical object quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenesis process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
parachordal vessel incomplete structure, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel truncated, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel absent, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
caudal vein plexus aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 4 from Kawamura et al., 2008
blood circulation decreased occurrence, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-vegfaa standard conditions Fig. 3 with image from Stahlhut et al., 2012
axial vasculature kdrl expression spatial pattern, abnormal clec14aci15/ci15 + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental artery decreased diameter, abnormal s916Tg + MO1-vegfaa standard conditions Fig. 3 from Klems et al., 2020
caudal vein plexus malformed, abnormal sd2Tg + MO1-nlgn1 + MO1-vegfaa standard conditions Fig. 4 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-hs6st2 standard conditions Fig. 5 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-nrxn1a standard conditions Fig. 4 from Rissone et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO1-bmal1a + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
blood circulation decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel non-functional, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-peak1 + MO1-vegfaa standard conditions Fig. 2 with image from Wang et al., 2018
intersegmental vessel increased length, abnormal y1Tg + MO1-per2 + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel morphology, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vein decreased size, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis paedomorphic growth, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenic sprout physical object quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel immature, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel decreased length, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel decreased amount, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel dorsal region branchiness, ameliorated flt1ka601/ka601; s843Tg + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
intersegmental vessel vascular sprouts amount, ameliorated flt1ka601/ka601; s843Tg + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
intersegmental artery normal diameter, ameliorated ka613Tg; s916Tg + MO1-vegfaa standard conditions Fig. 3 from Klems et al., 2020
Citations