Morpholino

MO1-vegfaa

ID
ZDB-MRPHLNO-050513-12
Name
MO1-vegfaa
Previous Names
  • MO1-vegf
  • MO1-vegfa
  • VEGF-A-1 (1)
  • vegfMO (1)
Target
Sequence
5' - GTATCAAATAAACAACCAAGTTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vegfaa
No data available
Phenotype
Phenotype resulting from MO1-vegfaa
Phenotype Fish Figures
angioblast cell migration delayed, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
angiogenesis disrupted, abnormal WT + MO1-vegfaa Fig. 4 with image from Jing et al., 2013
angiogenesis process quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
angiogenic sprout absent, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
angiogenic sprout physical object quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
aortic arch 5 absent, abnormal la116Tg + MO1-vegfaa Fig. 1 from Nicoli et al., 2010
axial vasculature kdrl expression spatial pattern, abnormal WT + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
blood circulation arrested, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
blood circulation decreased occurrence, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
cardiac ventricle decreased contractility, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
caudal vein plexus aplastic, abnormal y1Tg + MO1-vegfaa Fig. 4 from Kawamura et al., 2008
dorsal aorta broken, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
Fig. 6 from Hooper et al., 2009
intersegmental artery malformed, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-vegfaa Fig. 2 from Weijts et al., 2012
intersegmental vessel absent, abnormal y1Tg + MO1-vegfaa Fig. 3 with image from Jensen et al., 2015
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal y1Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-vegfaa Fig. 3 with image from Stahlhut et al., 2012
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-vegfaa Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal y1Tg + MO1-vegfaa Fig. 3 with image from Jensen et al., 2012
intersegmental vessel truncated, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
pericardium edematous, abnormal WT + MO1-vegfaa Fig. 4 from Rottbauer et al., 2005
sprouting angiogenesis delayed, abnormal s843Tg + MO1-vegfaa Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-vegfaa Fig. 1 from Li et al., 2014
vein broken, abnormal WT + MO1-vegfaa Fig. 8 with image from Childs et al., 2002
Phenotype of all Fish created by or utilizing MO1-vegfaa
Phenotype Fish Conditions Figures
angioblast cell migration delayed, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
blood circulation arrested, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
angiogenesis disrupted, abnormal WT + MO1-vegfaa standard conditions Fig. 4 with image from Jing et al., 2013
axial vasculature kdrl expression spatial pattern, abnormal WT + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
angiogenic sprout absent, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
pericardium edematous, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle non-contractile, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
cardiac ventricle decreased contractility, abnormal WT + MO1-vegfaa standard conditions Fig. 4 from Rottbauer et al., 2005
vein broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
dorsal aorta broken, abnormal WT + MO1-vegfaa standard conditions Fig. 8 with image from Childs et al., 2002
aortic arch 5 absent, abnormal la116Tg + MO1-vegfaa standard conditions Fig. 1 from Nicoli et al., 2010
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental vessel decreased amount, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
angiogenic sprout physical object quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenesis process quality, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
parachordal vessel incomplete structure, abnormal s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel truncated, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel absent, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 1 from Li et al., 2014
Fig. 4 from Kawamura et al., 2008
caudal vein plexus aplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 4 from Kawamura et al., 2008
blood circulation decreased occurrence, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel shortened, abnormal y1Tg + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-vegfaa standard conditions Fig. 3 with image from Stahlhut et al., 2012
axial vasculature kdrl expression spatial pattern, abnormal clec14aci15/ci15 + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental artery decreased diameter, abnormal s916Tg + MO1-vegfaa standard conditions Fig. 3 from Klems et al., 2020
caudal vein plexus malformed, abnormal sd2Tg + MO1-nlgn1 + MO1-vegfaa standard conditions Fig. 4 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-hs6st2 standard conditions Fig. 5 from Rissone et al., 2012
caudal vein plexus malformed, abnormal sd2Tg + MO1-vegfaa + MO2-nrxn1a standard conditions Fig. 4 from Rissone et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO1-bmal1a + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
blood circulation decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel non-functional, abnormal y1Tg + MO1-igfbp7 + MO1-vegfaa standard conditions Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-peak1 + MO1-vegfaa standard conditions Fig. 2 with image from Wang et al., 2018
intersegmental vessel increased length, abnormal y1Tg + MO1-per2 + MO1-vegfaa standard conditions Fig. 3 with image from Jensen et al., 2012
intersegmental vessel morphology, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vein decreased size, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis paedomorphic growth, abnormal y1Tg + MO1-trpc1 + MO1-vegfaa standard conditions Fig. 7 from Yu et al., 2010
angiogenesis process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
angiogenic sprout physical object quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel hypoplastic, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
intersegmental artery malformed, abnormal s843Tg + MO1-e2f7 + MO1-e2f8 + MO1-vegfaa standard conditions Fig. 2 from Weijts et al., 2012
dorsal longitudinal anastomotic vessel immature, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel decreased length, abnormal clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel decreased amount, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
parachordal vessel incomplete structure, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO1-vegfaa standard conditions Fig. 5 with image from Pociute et al., 2019
intersegmental vessel dorsal region branchiness, ameliorated flt1ka601/ka601; s843Tg + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
intersegmental vessel vascular sprouts amount, ameliorated flt1ka601/ka601; s843Tg + MO1-vegfaa standard conditions Fig. 8 with image from Wild et al., 2017
intersegmental artery normal diameter, ameliorated ka613Tg; s916Tg + MO1-vegfaa standard conditions Fig. 3 from Klems et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.