Morpholino
MO1-vegfaa
- ID
- ZDB-MRPHLNO-050513-12
- Name
- MO1-vegfaa
- Previous Names
- Target
- Sequence
-
5' - GTATCAAATAAACAACCAAGTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vegfaa
No data available
Phenotype
Phenotype resulting from MO1-vegfaa
1 - 5 of 30 Show all
Phenotype of all Fish created by or utilizing MO1-vegfaa
1 - 5 of 66 Show all
Citations
- Dong, X., Jiang, D., Wang, L., Zhao, J., Yu, L., Huang, Y., Wu, X., Zhu, Y., Zhao, Y., Zhao, Q., Zhang, G., Li, X. (2022) VPS28 regulates brain vasculature by controlling neuronal VEGF trafficking through extracellular vesicle secretion. iScience. 25:104042
- Metikala, S., Warkala, M., Casie Chetty, S., Chestnut, B., Rufin Florat, D., Plender, E., Nester, O., Koenig, A.L., Astrof, S., Sumanas, S. (2022) Integration of vascular progenitors into functional blood vessels represents a distinct mechanism of vascular growth. Developmental Cell. 57(6):767-782.e6
- Mitra, S., Devi, S., Lee, M.S., Jui, J., Sahu, A., Goldman, D. (2022) Vegf signaling between Müller glia and vascular endothelial cells is regulated by immune cells and stimulates retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 119:e2211690119e2211690119
- Tsao, K.C., Lin, Y.C., Chen, Y.T., Lai, S.L., Yang, R.B. (2021) Zebrafish scube1 and scube2 cooperate in promoting Vegfa signaling during embryonic vascularization. Cardiovascular research. 118(4):1074-1087
- Wang, Y., Pasparakis, C., Grosell, M. (2021) Role of the cardiovascular system in ammonia excretion in early life stages of zebrafish (Danio rerio). American journal of physiology. Regulatory, integrative and comparative physiology. 321(3):R377-R384
- Klems, A., van Rijssel, J., Ramms, A.S., Wild, R., Hammer, J., Merkel, M., Derenbach, L., Préau, L., Hinkel, R., Suarez-Martinez, I., Schulte-Merker, S., Vidal, R., Sauer, S., Kivelä, R., Alitalo, K., Kupatt, C., van Buul, J.D., le Noble, F. (2020) The GEF Trio controls endothelial cell size and arterial remodeling downstream of Vegf signaling in both zebrafish and cell models. Nature communications. 11:5319
- Hughes, M.C., Zimmer, A.M., Perry, S.F. (2019) The role of internal convection in respiratory gas transfer and aerobic metabolism in larval zebrafish ( Danio rerio). American journal of physiology. Regulatory, integrative and comparative physiology. 316(3):R255-R264
- Lai, J.K.H., Gagalova, K.K., Kuenne, C., El-Brolosy, M.A., Stainier, D.Y.R. (2019) Induction of interferon-stimulated genes and cellular stress pathways by morpholinos in zebrafish. Developmental Biology. 454(1):21-28
- Pociute, K., Schumacher, J.A., Sumanas, S. (2019) Clec14a genetically interacts with Etv2 and Vegf signaling during vasculogenesis and angiogenesis in zebrafish. BMC Developmental Biology. 19:6
- Toselli, C.M., Wilkinson, B.M., Paterson, J., Kieffer, T.J. (2019) Vegfa/vegfr2 signaling is necessary for zebrafish islet vessel development, but is dispensable for beta-cell and alpha-cell formation. Scientific Reports. 9:3594
1 - 10 of 50
Show