Morpholino

MO1-sufu

ID

ZDB-MRPHLNO-050308-7

Name

MO1-sufu

Previous Names

su(fu) MO2 (1)

Target

sufu (1)

Sequence

5' - CGCCAAACAGGGAAAAGTTCTCGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino that targets sufu.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-sufu

No data available

Phenotype

Phenotype resulting from MO1-sufu

Phenotype	Fish	Figures
fast muscle cell increased amount, abnormal	WT + MO1-sufu	Fig. 7 from Wolff et al., 2003
myotome ptch2 expression increased distribution, abnormal	WT + MO1-sufu	Fig. 7 from Maurya et al., 2013
myotome ab1-eng labeling increased distribution, abnormal	WT + MO1-sufu	Fig. 7 from Maurya et al., 2013
myotome prox1a expression increased distribution, abnormal	WT + MO1-sufu	Fig. 7 from Maurya et al., 2013
regulation of smoothened signaling pathway disrupted, abnormal	WT + MO1-sufu	Fig. 7 from Wolff et al., 2003
slow muscle cell increased amount, abnormal	WT + MO1-sufu	Fig. 7 from Maurya et al., 2013 Fig. 7 from Wolff et al., 2003

Phenotype of all Fish created by or utilizing MO1-sufu

Phenotype	Fish	Conditions	Figures
regulation of smoothened signaling pathway disrupted, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
myotome prox1a expression increased distribution, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
fast muscle cell increased amount, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
myotome ptch2 expression increased distribution, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
myotome ab1-eng labeling increased distribution, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
slow muscle cell increased amount, abnormal	WT + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013 Fig. 7 from Wolff et al., 2003
slow muscle cell increased amount, abnormal	WT + MO1-sufu + MO2-sufu	standard conditions	Fig. ST2 from Flynt et al., 2007
muscle pioneer absent, abnormal	gli1^ts269/ts269 + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal	gli1^ts269/ts269 + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
muscle pioneer decreased amount, abnormal	gli2a^ty119/+ + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal	gli2a^ty119/+ + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
myotome prox1a expression increased distribution, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
muscle pioneer increased amount, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
spinal cord foxa expression mislocalised, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 8 from Maurya et al., 2013
myotome ptch2 expression increased distribution, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
slow muscle cell increased amount, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
myotome ab1-eng labeling increased distribution, abnormal	kif7^i271/i271 + MO1-sufu	standard conditions	Fig. 7 from Maurya et al., 2013
myotome fast muscle cell increased amount, abnormal	WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu	standard conditions	Fig. 7 from Tay et al., 2005
myotome muscle pioneer increased amount, abnormal	WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu	standard conditions	Fig. 7 from Tay et al., 2005
slow muscle cell disorganized, abnormal	WT + MO1-mir214a + MO1-sufu + MO2-sufu	standard conditions	Fig. 4 from Flynt et al., 2007
fast muscle cell increased amount, abnormal	WT + MO1-stk36 + MO1-sufu	standard conditions	Fig. 7 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal	WT + MO1-sufu + MO2-gli2a	standard conditions	Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal	WT + MO1-sufu + MO2-gli2a	standard conditions	Fig. 7 from Wolff et al., 2003
myotome EGFP expression increased distribution, abnormal	kif7^i271/i271; i233Tg + MO1-gli1 + MO1-sufu	standard conditions	Fig. 6 from Maurya et al., 2013

Citations