Morpholino

MO1-sufu

ID
ZDB-MRPHLNO-050308-7
Name
MO1-sufu
Previous Names
  • su(fu) MO2 (1)
Target
Sequence
5' - CGCCAAACAGGGAAAAGTTCTCGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets sufu.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sufu
No data available
Phenotype
Phenotype resulting from MO1-sufu
Phenotype of all Fish created by or utilizing MO1-sufu
Phenotype Fish Conditions Figures
myotome Ab1-en labeling increased distribution, abnormal WT + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
myotome prox1a expression increased distribution, abnormal WT + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
fast muscle cell increased amount, abnormal WT + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
myotome ptch2 expression increased distribution, abnormal WT + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
slow muscle cell increased amount, abnormal WT + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
Fig. 7 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-sufu + MO2-sufu standard conditions Fig. ST2 from Flynt et al., 2007
muscle pioneer absent, abnormal gli1ts269/ts269 + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal gli1ts269/ts269 + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
muscle pioneer decreased amount, abnormal gli2aty119/+ + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal gli2aty119/+ + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
myotome Ab1-en labeling increased distribution, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
myotome prox1a expression increased distribution, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
muscle pioneer increased amount, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
spinal cord foxa expression mislocalised, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 8 with image from Maurya et al., 2013
myotome ptch2 expression increased distribution, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
slow muscle cell increased amount, abnormal kif7i271/i271 + MO1-sufu standard conditions Fig. 7 with image from Maurya et al., 2013
myotome fast muscle cell increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
myotome muscle pioneer increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
slow muscle cell disorganized, abnormal WT + MO1-mir214a + MO1-sufu + MO2-sufu standard conditions Fig. 4 from Flynt et al., 2007
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-sufu + MO2-gli2a standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-sufu + MO2-gli2a standard conditions Fig. 7 from Wolff et al., 2003
myotome EGFP expression increased distribution, abnormal kif7i271/i271; i233Tg + MO1-gli1 + MO1-sufu standard conditions Fig. 6 with image from Maurya et al., 2013
Citations