Morpholino

MO1-dlx3b

ID
ZDB-MRPHLNO-041109-1
Name
MO1-dlx3b
Previous Names
None
Target
Sequence
5' - ATGTCGGTCCACTCATCCTTAATAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dlx3b
Expressed Gene Anatomy Figures
cldna Fig. 7 with image from Hans et al., 2004
pax2a Fig. 7 with image from Hans et al., 2004
stm Fig. 7 with image from Hans et al., 2007
Phenotype
Phenotype resulting from MO1-dlx3b
Phenotype Fish Figures
lapillus absent, abnormal TU + MO1-dlx3b Fig. 6 with image from Sun et al., 2018
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b text only from Walker et al., 2006
otic vesicle decreased size, abnormal WT + MO1-dlx3b Fig. 7 with image from Hans et al., 2007
vestibular reflex decreased process quality, abnormal TU + MO1-dlx3b Fig. 2 with image from Sun et al., 2018
Phenotype of all Fish created by or utilizing MO1-dlx3b
Phenotype Fish Conditions Figures
lapillus absent, abnormal TU + MO1-dlx3b standard conditions Fig. 6 with image from Sun et al., 2018
vestibular reflex decreased process quality, abnormal TU + MO1-dlx3b standard conditions Fig. 2 with image from Sun et al., 2018
otic vesicle decreased size, abnormal WT + MO1-dlx3b standard conditions Fig. 7 with image from Hans et al., 2007
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b standard conditions text only from Walker et al., 2006
otic vesicle hair cell poorly differentiated, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle inner ear receptor cell differentiation decreased process quality, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle decreased size, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle morphogenesis decreased process quality, abnormal AB + MO1-dlx3b + MO1-dlx4b standard conditions Fig. 2 with image from Hans et al., 2013
interhyal-epihyal joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
otic vesicle aplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 7 with image from Hans et al., 2007
otic vesicle hypoplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 1 with image from Bhat et al., 2013
opercle fused with branchiostegal ray, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
mandibular arch skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage tapered, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage decreased length, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage morphology, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
pharyngeal arch 2 skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
otic vesicle decreased size, abnormal b1193Tg + MO1-dlx3b (AB) heat shock Fig. 7 with image from Hans et al., 2007
otic vesicle aplastic, abnormal b1193Tg + MO1-dlx3b + MO2-foxi1 (AB) heat shock Fig. 7 with image from Hans et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.