Fig. S2
- ID
- ZDB-IMAGE-080310-2
- Genes
- Publication
- Smith et al., 2006 - Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblast differentiation and function
- All Figures
- Figures for Smith et al., 2006
Fig. S2 RT-PCR analysis of various cartilage and bone genes on caudal fins of 30-day-old larvae and 4 dpa fin regenerates. Total RNA was prepared from 50 caudal fins of 30-day-old larvae using Trizol (Invitrogen) (samples only contained the distal half of the fin to avoid the endochondral bones at the base of the fin rays) and from 20 fin regenerates. RNA was reverse-transcribed using Superscript II Reverse Transcriptase (Invitrogen). Gene specific primers (see below) to amplify cDNA fragments for the transcription factors sox9a, sox9b, runx2a and runx2b; the signaling molecules bmp2b, bmp6 and ihha; and the extracellular matrix molecule col10a1 were used for PCR analysis. cDNA from 4-day regenerates was used as a positive control for gene expression, and a water control was used as a negative control. The PCR products were ran on an agarose gel beside a GeneRuler DNA Ladder Mix. (A, B) runx2a, runx2b, sox9a and sox9b and (A) bmp2b, bmp6, ihha and col10a1 (B) were all expressed in 4-day regenerates and 30-day larvae fins. For runx2a, runx2b, sox9a, sox9b and bmp6 primers, see Materials and methods. Other gene specific primers used: ihha forward: 5′ATGCGTCTCCCCGTGGTGTT3′ ihha; reverse: 52TCATCTATCATTGTCCATCATGC3′. bmp2b forward: 5′TTGGACTCATTCCCGAGATCG3&prime& bmp2b reverse: 5′GTACTCGTCCAGGTACAGCA3′. col10a1 forward: 5′ATGTCCATTGCTCTTTCTCTG3&prime& col10a1 reverse: 5′CATAATGGTTTACAGAGCAAA3′.
Reprinted from Developmental Biology, 299(2), Smith, A., Avaron, F., Guay, D., Padhi, B.K., and Akimenko, M.A., Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblast differentiation and function, 438-454, Copyright (2006) with permission from Elsevier. Full text @ Dev. Biol.