CRISPR

CRISPR6-aip

ID
ZDB-CRISPR-260513-2
Name
CRISPR6-aip
Previous Names
None
Target
Sequence
5' - AGCGTCCAGGTGATGAGCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
wh239 aip
Expression
Gene expression in Wild Types + CRISPR6-aip
No data available
Phenotype
Phenotype resulting from CRISPR6-aip
No data available
Phenotype of all Fish created by or utilizing CRISPR6-aip
Phenotype Fish Conditions Figures
axis decreased object quality, abnormal aipwh239/wh239 chemical treatment by environment: Benzo[k]fluoranthene FIGURE 1 with image from Perone et al., 2026
pericardium edematous, abnormal aipwh239/wh239 chemical treatment by environment: 5-Nitroacenaphthene FIGURE 1 with image from Perone et al., 2026
cellular response to stress increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
brain malformed, abnormal aipwh239/wh239 chemical treatment by environment: leflunomide FIGURE 1 with image from Perone et al., 2026
cranium malformed, ameliorated aipwh239/wh239 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl FIGURE 1 with image from Perone et al., 2026
pericardium edematous, abnormal aipwh239/wh239 chemical treatment by environment: Benzo[k]fluoranthene FIGURE 1 with image from Perone et al., 2026
regulation of response to oxidative stress increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
cranium malformed, exacerbated aipwh239/wh239 chemical treatment by environment: leflunomide FIGURE 1 with image from Perone et al., 2026
cranium malformed, abnormal aipwh239/wh239 chemical treatment by environment: Benzo[k]fluoranthene FIGURE 1 with image from Perone et al., 2026
thigmotaxis decreased process quality, abnormal aipwh239/wh239 chemical treatment by environment: leflunomide FIGURE 1 with image from Perone et al., 2026
startle response increased magnitude, abnormal aipwh239/wh239 acoustic radiation FIGURE 2 with image from Perone et al., 2026
regulation of cell division decreased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
brain malformed, ameliorated aipwh239/wh239 chemical treatment by environment: 5-Nitroacenaphthene FIGURE 1 with image from Perone et al., 2026
pericardium edematous, ameliorated aipwh239/wh239 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl FIGURE 1 with image from Perone et al., 2026
gene expression decreased process quality, abnormal aipwh239/wh239 standard conditions FIGURE 9 with image,  FIGURE 10 with image from Perone et al., 2026
brain malformed, abnormal aipwh239/wh239 chemical treatment by environment: Benzo[k]fluoranthene FIGURE 1 with image from Perone et al., 2026
cranium malformed, abnormal aipwh239/wh239 chemical treatment by environment: 5-Nitroacenaphthene FIGURE 1 with image from Perone et al., 2026
startle response increased magnitude, abnormal aipwh239/wh239 lighting conditions FIGURE 2 with image from Perone et al., 2026
fin malformed, ameliorated aipwh239/wh239 chemical treatment by environment: Benzo[k]fluoranthene FIGURE 1 with image from Perone et al., 2026
response to light stimulus increased magnitude, abnormal aipwh239/wh239 acoustic radiation FIGURE 2 with image from Perone et al., 2026
cellular response to nutrient increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
lipid metabolic process increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
muscle malformed, ameliorated aipwh239/wh239 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl FIGURE 1 with image from Perone et al., 2026
whole organism aip expression decreased amount, abnormal aipwh239/wh239 standard conditions FIGURE 5 with image from Perone et al., 2026
response to light stimulus increased magnitude, exacerbated aipwh239/wh239 lighting conditions, chemical treatment by environment: leflunomide FIGURE 3 with image from Perone et al., 2026
xenobiotic metabolic process increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
response to light stimulus increased magnitude, abnormal aipwh239/wh239 lighting conditions FIGURE 2 with image from Perone et al., 2026
thigmotaxis decreased process quality, abnormal aipwh239/wh239 chemical treatment by environment: 5-Nitroacenaphthene FIGURE 1 with image from Perone et al., 2026
amino acid metabolic process increased occurrence, abnormal aipwh239/wh239 standard conditions FIGURE 6 with image from Perone et al., 2026
pericardium edematous, exacerbated aipwh239/wh239 chemical treatment by environment: leflunomide FIGURE 1 with image from Perone et al., 2026
axis decreased object quality, exacerbated aipwh239/wh239 chemical treatment by environment: 5-Nitroacenaphthene FIGURE 1 with image from Perone et al., 2026
whole organism aip expression decreased amount, abnormal aipwh239/wh239 (TL) standard conditions Fig. 6. with image from Karchner et al., 2026
whole organism viability, abnormal aipwh239/wh239 (TL) standard conditions Fig. 3. with image from Karchner et al., 2026
whole organism dead, abnormal aipwh239/wh239 (TL) standard conditions Fig. 3. with image from Karchner et al., 2026
whole organism aip expression decreased amount, abnormal aipwh239/+ standard conditions FIGURE 5 with image from Perone et al., 2026
whole organism aip expression decreased amount, abnormal aipwh239/+ (TL) standard conditions Fig. 6. with image from Karchner et al., 2026
Citations