CRISPR

CRISPR5-aip

ID
ZDB-CRISPR-260513-1
Name
CRISPR5-aip
Previous Names
None
Target
Sequence
5' - GGTTACCACTATGAAAGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
wh86 aip
Expression
Gene expression in Wild Types + CRISPR5-aip
No data available
Phenotype
Phenotype resulting from CRISPR5-aip
No data available
Phenotype of all Fish created by or utilizing CRISPR5-aip
Phenotype Fish Conditions Figures
cellular response to stress increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
regulation of response to oxidative stress increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
cellular response to nutrient increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
lipid metabolic process increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
regulation of cell division decreased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
whole organism aip expression decreased amount, abnormal aipwh86/wh86 standard conditions FIGURE 5 with image from Perone et al., 2026
gene expression decreased process quality, abnormal aipwh86/wh86 standard conditions FIGURE 9 with image,  FIGURE 10 with image from Perone et al., 2026
amino acid metabolic process increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
xenobiotic metabolic process increased occurrence, abnormal aipwh86/wh86 standard conditions FIGURE 6 with image from Perone et al., 2026
response to 2,3,7,8-tetrachlorodibenzodioxine decreased process quality, abnormal aipwh86/wh86 (TL) chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4. with image from Karchner et al., 2026
whole organism morphology, ameliorated aipwh86/wh86 (TL) chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4. with image from Karchner et al., 2026
yolk composition, ameliorated aipwh86/wh86 (TL) chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 4. with image from Karchner et al., 2026
pericardium composition, ameliorated aipwh86/wh86 (TL) chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 4. with image from Karchner et al., 2026
whole organism dead, abnormal aipwh86/wh86 (TL) standard conditions Fig. 3. with image from Karchner et al., 2026
whole organism viability, abnormal aipwh86/wh86 (TL) standard conditions Fig. 3. with image from Karchner et al., 2026
whole organism aip expression decreased amount, abnormal aipwh86/+ standard conditions FIGURE 5 with image from Perone et al., 2026
pericardium edematous, abnormal aipwh86/+ (TL) chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 4. with image from Karchner et al., 2026
yolk edematous, abnormal aipwh86/+ (TL) chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 4. with image from Karchner et al., 2026
whole organism morphology, abnormal aipwh86/+ (TL) chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4. with image from Karchner et al., 2026
Citations