CRISPR

CRISPR6-hoxd13a

ID

ZDB-CRISPR-260422-9

Name

CRISPR6-hoxd13a

Previous Names

None

Target

hoxd13a (1)

Sequence

5' - GTGACAAGTTAATTCTTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ot1015	hoxd13a

Expression

Gene expression in Wild Types + CRISPR6-hoxd13a

No data available

Phenotype

Phenotype resulting from CRISPR6-hoxd13a

No data available

Phenotype of all Fish created by or utilizing CRISPR6-hoxd13a

Phenotype	Fish	Conditions	Figures
pelvic fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched anal fin ray shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched anal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
dorsal fin grem1b expression decreased amount, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 8 from Corcoran et al., 2026
branched dorsal fin ray joint absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
branched dorsal fin ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 , Fig 4 from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
pelvic fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 from Corcoran et al., 2026
branched dorsal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
dorsal fin lepidotrichium 4 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
anal fin grem1b expression decreased amount, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 8 from Corcoran et al., 2026
caudal fin procurrent ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
dorsal fin lepidotrichium 2 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
pectoral fin lepidotrichium bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 from Corcoran et al., 2026
branched anal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
pelvic fin lepidotrichium bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
branched caudal fin ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 , Fig 4 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin anterior-posterior axis shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 5 from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
branched dorsal fin ray increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
dorsal fin anterior-posterior axis shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 5 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
branched dorsal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 from Corcoran et al., 2026
dorsal fin lepidotrichium 6 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
branched caudal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026

Citations