CRISPR

CRISPR1-bcl3

ID

ZDB-CRISPR-260209-16

Name

CRISPR1-bcl3

Previous Names

None

Target

bcl3 (1)

Sequence

5' - GGAGAGCAAAGAACGGCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
umo201	bcl3

Expression

Gene expression in Wild Types + CRISPR1-bcl3

No data available

Phenotype

Phenotype resulting from CRISPR1-bcl3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-bcl3

Phenotype	Fish	Conditions	Figures
spleen mpx expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
kidney rag2 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
spleen cxcl8a expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism viability, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
swimming behavior decreased process quality, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 2 from Fan et al., 2025
whole organism mxc expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
whole organism fndc1 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 from Fan et al., 2025
whole organism ifnphi3 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 6 from Fan et al., 2025
pericardium edematous, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 from Fan et al., 2025
liver rag2 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
whole organism il6 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
whole organism mxc expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
yolk swollen, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
muscle cxcl8a expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
whole organism ifnphi1 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 6 from Fan et al., 2025
feeding behavior decreased process quality, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 2 from Fan et al., 2025
whole organism viability, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
kidney mpeg1.1 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
thymus structure, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
swim bladder uninflated, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 from Fan et al., 2025
liver tnfa expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
spleen mpeg1.1 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
spleen il1b expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism fndc1 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
whole organism ifnphi1 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
whole organism decreased area, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 1 from Fan et al., 2025
whole organism viability, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 6 from Fan et al., 2025
muscle il6 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism mxc expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
swim bladder uninflated, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
muscle tnfa expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism cxcl8a expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
muscle tnfa expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
whole organism ifnphi3 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
hepatocyte nucleus displaced, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
whole organism tnfa expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
whole organism il1b expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
whole organism il10 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
spleen rag2 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
whole organism il6 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
liver cxcl8a expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
spleen il6 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
liver il6 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
spleen cxcl8a expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
yolk swollen, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 from Fan et al., 2025
whole organism pkz expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
whole organism il1b expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
liver il1b expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
kidney cd79a expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
whole organism pkz expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
liver cxcl8a expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
spleen tnfa expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism viability, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 1 , Figure 7 from Fan et al., 2025
muscle il1b expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
hepatocyte chromatin condensed, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
whole organism cxcl8a expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
muscle il1b expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
whole organism il6 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
whole organism tnfa expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 , Figure 6 from Fan et al., 2025
liver mpeg1.1 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
spleen il1b expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
whole organism decreased weight, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 1 from Fan et al., 2025
kidney mpx expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
liver il6 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
thymus composition, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 3 from Fan et al., 2025
liver tnfa expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
whole organism cxcl8a expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
spleen tnfa expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
spleen il6 expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
yolk necrotic, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
whole organism decreased length, abnormal	bcl3^{umo201/umo201} (AB)	standard conditions	Figure 1 from Fan et al., 2025
whole organism tnfa expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025
pericardium edematous, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
whole organism il10 expression decreased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide	Figure 5 from Fan et al., 2025
whole organism il1b expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: poly(I:C)	Figure 5 from Fan et al., 2025
muscle cxcl8a expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: dexamethasone	Figure 7 from Fan et al., 2025
muscle il6 expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
liver il1b expression increased amount, abnormal	bcl3^{umo201/umo201} (AB)	control	Figure 7 from Fan et al., 2025
whole organism pkz expression amount, ameliorated	bcl3^{umo201/umo201} (AB)	chemical treatment by injection: lipopolysaccharide, chemical treatment by injection: dexamethasone	Figure 6 from Fan et al., 2025

Citations