CRISPR

CRISPR3-cdc27

ID
ZDB-CRISPR-241218-3
Name
CRISPR3-cdc27
Previous Names
None
Target
Sequence
5' - GTCGATAGCTCTCTATACGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4220 cdc27
Expression
Gene expression in Wild Types + CRISPR3-cdc27
No data available
Phenotype
Phenotype resulting from CRISPR3-cdc27
No data available
Phenotype of all Fish created by or utilizing CRISPR3-cdc27
Phenotype Fish Conditions Figures
whole organism tp53 expression increased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 9 with image from Song et al., 2024
pharyngeal arch immature, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
pericardium edematous, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 4 with image,  Figure 5 with image from Song et al., 2024
head decreased size, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
hyosymplectic cartilage absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
whole organism col2a1a expression decreased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 9 with image from Song et al., 2024
whole organism cdc27 expression decreased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 9 with image from Song et al., 2024
ethmoid cartilage hypoplastic, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
cranium morphology, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 4 with image from Song et al., 2024
apoptotic process increased occurrence, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 11 with image from Song et al., 2024
ceratohyal cartilage absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
spinal cord malformed, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
palatoquadrate cartilage absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
pharyngeal arch sox9a expression decreased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 8 with image from Song et al., 2024
Meckel's cartilage absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
eye decreased size, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
spinal cord curved, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
ceratobranchial cartilage absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 6 with image from Song et al., 2024
chondrocyte decreased size, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 7 with image from Song et al., 2024
whole organism cdkn1a expression increased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 9 with image from Song et al., 2024
pharyngeal arch cartilage dysplastic, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 7 with image from Song et al., 2024
pharyngeal arch col2a1a expression absent, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 8 with image from Song et al., 2024
whole organism sox9a expression decreased amount, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 9 with image from Song et al., 2024
ventral mandibular arch immature, abnormal cdc27zf4220/zf4220 (TU) standard conditions Figure 5 with image from Song et al., 2024
pericardium edematous, abnormal TU + CRISPR1-cdc27 + CRISPR2-cdc27 + CRISPR3-cdc27 + CRISPR4-cdc27 standard conditions Figure 4 with image from Song et al., 2024
cranium morphology, abnormal TU + CRISPR1-cdc27 + CRISPR2-cdc27 + CRISPR3-cdc27 + CRISPR4-cdc27 standard conditions Figure 4 with image from Song et al., 2024
spinal cord malformed, abnormal TU + CRISPR1-cdc27 + CRISPR2-cdc27 + CRISPR3-cdc27 + CRISPR4-cdc27 standard conditions Figure 4 with image from Song et al., 2024
cranial neural crest cell cell population proliferation decreased occurrence, abnormal cdc27zf4220/zf4220; ba2Tg standard conditions Figure 10 with image,  Figure 12 with image from Song et al., 2024
apoptotic process occurrence, ameliorated cdc27zf4220/zf4220 + CRISPR18-cdkn1a + CRISPR19-cdkn1a + CRISPR20-cdkn1a (TU) standard conditions Figure 11 with image from Song et al., 2024
pharyngeal arch morphology, ameliorated cdc27zf4220/zf4220 + CRISPR18-cdkn1a + CRISPR19-cdkn1a + CRISPR20-cdkn1a (TU) standard conditions Figure 6 with image from Song et al., 2024
apoptotic process occurrence, ameliorated cdc27zf4220/zf4220 + CRISPR23-tp53 (TU) standard conditions Figure 11 with image from Song et al., 2024
pharyngeal arch morphology, ameliorated cdc27zf4220/zf4220 + CRISPR23-tp53 (TU) standard conditions Figure 6 with image from Song et al., 2024
cranial neural crest cell cell population proliferation normal process quality, ameliorated cdc27zf4220/zf4220; ba2Tg + CRISPR18-cdkn1a + CRISPR19-cdkn1a + CRISPR20-cdkn1a standard conditions Figure 12 with image from Song et al., 2024
cranial neural crest cell cell population proliferation normal process quality, ameliorated cdc27zf4220/zf4220; ba2Tg + CRISPR23-tp53 standard conditions Figure 12 with image from Song et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.