CRISPR

CRISPR1-epm2a

ID

ZDB-CRISPR-221219-2

Name

CRISPR1-epm2a

Previous Names

None

Target

epm2a (1)

Sequence

5' - GGAGCCGTGCCTGTGGACCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3794	epm2a

Expression

Gene expression in Wild Types + CRISPR1-epm2a

No data available

Phenotype

Phenotype resulting from CRISPR1-epm2a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-epm2a

Phenotype	Fish	Conditions	Figures
whole organism epm2a expression decreased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 2 from Della Vecchia et al., 2022
whole organism kcnj10b expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
brain glycogen increased distribution, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 3 from Della Vecchia et al., 2022
whole organism becn1 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism ab2-map1lc3 labeling increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism tnfa expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
whole organism atg12 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism mtor expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism tfeb expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
locomotion process quality, ameliorated	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	chemical treatment by environment: trehalose	Fig. 8 from Della Vecchia et al., 2022
whole organism csf1ra expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
apoptotic process increased process quality, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
whole organism ab4-atg5 labeling increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism decreased length, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 2 from Della Vecchia et al., 2022
forebrain action potential initiation increased process quality, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 4 , Fig. 8 from Della Vecchia et al., 2022
whole organism atg5 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism il10 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
whole organism gfap expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
locomotion increased process quality, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 4 , Fig. 8 from Della Vecchia et al., 2022
forebrain action potential initiation increased frequency, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 4 from Della Vecchia et al., 2022
whole organism p2ry12 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
whole organism map1lc3a expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
forebrain action potential initiation process quality, ameliorated	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	chemical treatment by environment: trehalose	Fig. 8 from Della Vecchia et al., 2022
whole organism sqstm1 expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 7 from Della Vecchia et al., 2022
whole organism hexb expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
swimming behavior process quality, ameliorated	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	chemical treatment by environment: trehalose	Fig. 8 from Della Vecchia et al., 2022
whole organism il1b expression increased amount, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 6 from Della Vecchia et al., 2022
whole organism increased concentration whole organism glycogen, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 3 from Della Vecchia et al., 2022
swimming behavior decreased process quality, abnormal	mitfa^w2/+; epm2a^{zf3794/zf3794}; icm05Tg (AB)	standard conditions	Fig. 5 , Fig. 8 from Della Vecchia et al., 2022

Citations