CRISPR

CRISPR1-cyp4v2a

ID
ZDB-CRISPR-220921-2
Name
CRISPR1-cyp4v2a
Previous Names
  • CRISPR1-cyp4v8
Target
Sequence
5' - TGAGTGACATCATCACCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu15 cyp4v2a
Expression
Gene expression in Wild Types + CRISPR1-cyp4v2a
No data available
Phenotype
Phenotype resulting from CRISPR1-cyp4v2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cyp4v2a
Phenotype Fish Conditions Figures
whole organism cyp4v2b expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 1 with image from Gao et al., 2022
photoreceptor outer segment layer decreased thickness, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 2 with image from Gao et al., 2022
retinal pigmented epithelium cell shape, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 3 with image from Gao et al., 2022
retinal pigmented epithelium lipid droplet present, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 4 with image from Gao et al., 2022
whole organism ab2-gnat2 labeling decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 2 with image from Gao et al., 2022
whole organism hacl1 expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism fads2 expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism apoa1a expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism acsl1a expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism fabp4a expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
retinal pigmented epithelium cell degenerate, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 3 with image from Gao et al., 2022
retinal photoreceptor layer degenerate, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 2 with image from Gao et al., 2022
whole organism fabp7a expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism gnat1 expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 2 with image from Gao et al., 2022
whole organism cyp27a1.2 expression decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
whole organism Ab6-ppara labeling decreased amount, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. 5 with image from Gao et al., 2022
retinal pigmented epithelium cholesterol present, abnormal cyp4v2ahzu15/hzu15; cyp4v2bhzu14/hzu14 standard conditions Fig. S3 from Gao et al., 2022
Citations