CRISPR

CRISPR1-crhr1

ID
ZDB-CRISPR-220722-1
Name
CRISPR1-crhr1
Previous Names
None
Target
Sequence
5' - GGAAGGATTCGGGACAGGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ca403 crhr1
Expression
Gene expression in Wild Types + CRISPR1-crhr1
No data available
Phenotype
Phenotype resulting from CRISPR1-crhr1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-crhr1
Phenotype Fish Conditions Figures
swimming behavior increased process quality, abnormal crhr1ca403/ca403 standard conditions Fig. 5 from Faught et al., 2021
swimming behavior decreased process quality, abnormal crhr1ca403/ca403 mechanical stress Fig. 2 from Faught et al., 2021
cortisol secretion decreased process quality, abnormal crhr1ca403/ca403 mechanical stress Fig. 1 from Faught et al., 2021
whole organism cortisol decreased amount, abnormal crhr1ca403/ca403 mechanical stress Fig. 1 from Faught et al., 2021
whole organism cortisol increased amount, abnormal crhr1ca403/ca403 chemical treatment by environment: cortisol Fig. 5 from Faught et al., 2021
swimming behavior process quality, exacerbated crhr1ca403/ca403 chemical treatment by environment: cortisol Fig. 5 from Faught et al., 2021
dorsal telencephalon ab1-serotonin labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
telencephalon ab1-th labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
dorsal telencephalon ab1-th labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
hindbrain ab1-serotonin labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
whole organism hsp90aa1.1 expression increased amount, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 1 with image from Rajeswari et al., 2025
whole organism hsp90aa1.2 expression increased amount, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 1 with image from Rajeswari et al., 2025
thigmotaxis decreased process quality, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 3 with image,  Fig. 4 with image,  Fig. 7 with image from Rajeswari et al., 2025
hypothalamus ab1-th labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
whole organism dbh expression increased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 6 with image from Rajeswari et al., 2025
diencephalon ab1-th labeling decreased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 5 with image from Rajeswari et al., 2025
whole organism tph2 expression increased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 6 with image from Rajeswari et al., 2025
thigmotaxis decreased process quality, abnormal crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: cortisol Fig. 4 with image from Rajeswari et al., 2025
whole organism hsp70.1 expression increased amount, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 1 with image from Rajeswari et al., 2025
swimming behavior decreased process quality, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image from Rajeswari et al., 2025
thigmotaxis process quality, ameliorated crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: adrenaline Fig. 7 with image from Rajeswari et al., 2025
swimming behavior process quality, ameliorated crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: serotonin Fig. 7 with image from Rajeswari et al., 2025
swimming behavior decreased process quality, abnormal crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: cortisol Fig. 4 with image from Rajeswari et al., 2025
whole organism dnaja3b expression increased amount, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 1 with image from Rajeswari et al., 2025
whole organism cortisol decreased amount, abnormal crhr1ca403/ca403 (TL) heat shock Fig. 1 with image from Rajeswari et al., 2025
whole organism slc6a4a expression increased amount, abnormal crhr1ca403/ca403 (TL) standard conditions Fig. 6 with image from Rajeswari et al., 2025
swimming behavior process quality, ameliorated crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: adrenaline Fig. 7 with image from Rajeswari et al., 2025
thigmotaxis process quality, ameliorated crhr1ca403/ca403 (TL) heat shock, chemical treatment by environment: serotonin Fig. 7 with image from Rajeswari et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.