CRISPR

CRISPR1-p3h1

ID
ZDB-CRISPR-210201-4
Name
CRISPR1-p3h1
Previous Names
None
Target
Sequence
5' - GGAGACCGATTTCAAGGACCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
upv2 p3h1
Expression
Gene expression in Wild Types + CRISPR1-p3h1
No data available
Phenotype
Phenotype resulting from CRISPR1-p3h1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-p3h1
Phenotype Fish Conditions Figures
whole organism col1a1a expression decreased amount, abnormal p3h1upv2/upv2 standard conditions Figure 4 with image from Masiero et al., 2025
hemal arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
vertebral column antero-posteriorly flattened, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
vertebral column deformed, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
hemal arch acid phosphatase activity increased magnitude, exacerbated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 3 with image from Masiero et al., 2025
vertebra osteocyte apoptotic, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 5 with image from Masiero et al., 2025
hemal arch acid phosphatase activity increased magnitude, exacerbated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
vertebra acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 standard conditions Figure 3 with image from Masiero et al., 2025
vertebra decreased thickness, abnormal p3h1upv2/upv2 standard conditions Figure 1 with image from Masiero et al., 2025
vertebral body end plate posterior region decreased thickness, abnormal p3h1upv2/upv2 standard conditions Figure 2 with image from Masiero et al., 2025
neural arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 standard conditions Figure 3 with image from Masiero et al., 2025
vertebra osteocyte apoptotic, abnormal p3h1upv2/upv2 standard conditions Figure 5 with image from Masiero et al., 2025
vertebra collagen biosynthetic process decreased rate, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
vertebra osteocyte increased amount, abnormal p3h1upv2/upv2 standard conditions Figure 5 with image from Masiero et al., 2025
vertebral body end plate anterior region decreased thickness, abnormal p3h1upv2/upv2 standard conditions Figure 2 with image from Masiero et al., 2025
ceratohyal bone bone mineralization delayed, abnormal p3h1upv2/upv2 standard conditions Fig. 3 from Tonelli et al., 2020
notochord keratinous, abnormal p3h1upv2/upv2 standard conditions Fig. 7 from Tonelli et al., 2020
vertebra osteocyte increased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 5 with image from Masiero et al., 2025
vertebra decreased volume, abnormal p3h1upv2/upv2 standard conditions Figure 1 with image from Masiero et al., 2025
neural arch acid phosphatase activity increased magnitude, exacerbated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
whole organism bglap expression decreased amount, abnormal p3h1upv2/upv2 standard conditions Figure 4 with image from Masiero et al., 2025
neural arch acid phosphatase activity increased magnitude, exacerbated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 3 with image from Masiero et al., 2025
neural arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
vertebra osteocyte apoptotic, ameliorated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 5 with image from Masiero et al., 2025
osteoblast endoplasmic reticulum cisternal network increased size, abnormal p3h1upv2/upv2 standard conditions Fig. 6 from Tonelli et al., 2020
osteoblast endoplasmic reticulum lumen decreased width, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
vertebra osteocyte apoptotic, ameliorated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 5 with image from Masiero et al., 2025
vertebra osteocyte increased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 5 with image from Masiero et al., 2025
vertebra antero-posteriorly flattened, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
whole organism col1a1a expression amount, ameliorated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
vertebra bone tissue decreased volume, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
vertebra collagen biosynthetic process rate, ameliorated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
centrum decreased thickness, abnormal p3h1upv2/upv2 standard conditions Figure 2 with image from Masiero et al., 2025
vertebra collagen biosynthetic process decreased rate, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 4 with image from Masiero et al., 2025
vertebra decreased diameter, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
vertebra acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 3 with image from Masiero et al., 2025
chondroblast endoplasmic reticulum cisternal network increased size, abnormal p3h1upv2/upv2 standard conditions Fig. 6 from Tonelli et al., 2020
notochord bone mineralization delayed, abnormal p3h1upv2/upv2 standard conditions Fig. 3 from Tonelli et al., 2020
whole organism bglap expression amount, ameliorated p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
vertebra collagen biosynthetic process decreased rate, abnormal p3h1upv2/upv2 standard conditions Figure 4 with image from Masiero et al., 2025
whole organism bglap expression decreased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
vertebra misaligned with vertebra, abnormal p3h1upv2/upv2 standard conditions Fig. 4 from Tonelli et al., 2020
whole organism decreased length, abnormal p3h1upv2/upv2 standard conditions Fig. 3 from Tonelli et al., 2020
vertebral body end plate malformed, abnormal p3h1upv2/upv2 standard conditions Fig. 7 from Tonelli et al., 2020
whole organism col1a1a expression decreased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 4 with image from Masiero et al., 2025
hemal arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 standard conditions Figure 3 with image from Masiero et al., 2025
whole organism col1a1a expression decreased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 4 with image from Masiero et al., 2025
neural arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
vertebra osteocyte increased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 5 with image from Masiero et al., 2025
whole organism bglap expression decreased amount, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate Figure 4 with image from Masiero et al., 2025
hemal arch acid phosphatase activity increased magnitude, abnormal p3h1upv2/upv2 chemical treatment by environment: 4-phenylbutyrate, chemical treatment by environment: alendronic acid Figure 3 with image from Masiero et al., 2025
whole organism decreased length, abnormal p3h1upv2/+ standard conditions Fig. 3 from Tonelli et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.