CRISPR

CRISPR1-hoxd13a

ID
ZDB-CRISPR-190403-5
Name
CRISPR1-hoxd13a
Previous Names
None
Target
Sequence
5' - GGCTCTGGCTCCTTCACGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ot1015 hoxd13a
Expression
Gene expression in Wild Types + CRISPR1-hoxd13a
No data available
Phenotype
Phenotype resulting from CRISPR1-hoxd13a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-hoxd13a
Phenotype Fish Conditions Figures
pelvic fin lepidotrichium shortened, abnormal hoxa13aot1013/+; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal hoxa13aot1013/+; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal hoxa13aot1013/+; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal hoxa13aot1013/+; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
branched anal fin ray shortened, abnormal hoxa13aot1013/+; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/+; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/+; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/+; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/+; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
branched anal fin ray shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/+; hoxd13aot1015/ot1015 standard conditions Fig 2 with image from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/+ standard conditions Fig 3 with image from Corcoran et al., 2026
dorsal fin grem1b expression decreased amount, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 8 with image from Corcoran et al., 2026
branched dorsal fin ray joint absent, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 6 with image from Corcoran et al., 2026
branched dorsal fin ray actinotrichium absent, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image,  Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
pelvic fin lepidotrichium decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image from Corcoran et al., 2026
branched dorsal fin ray shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 6 with image from Corcoran et al., 2026
dorsal fin lepidotrichium 4 increased thickness, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 7 with image from Corcoran et al., 2026
anal fin grem1b expression decreased amount, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 8 with image from Corcoran et al., 2026
caudal fin procurrent ray actinotrichium absent, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
dorsal fin lepidotrichium 2 increased thickness, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 7 with image from Corcoran et al., 2026
pectoral fin lepidotrichium bifurcated, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image,  Fig 3 with image from Corcoran et al., 2026
branched anal fin ray bifurcated, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
pelvic fin lepidotrichium bifurcated, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
branched caudal fin ray actinotrichium absent, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image,  Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
anal fin anterior-posterior axis shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 5 with image from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 3 with image from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
branched dorsal fin ray increased thickness, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 6 with image from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
dorsal fin anterior-posterior axis shortened, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 5 with image from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 2 with image,  Fig 3 with image from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 3 with image,  Fig 4 with image from Corcoran et al., 2026
branched dorsal fin ray bifurcated, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 1 with image,  Fig 3 with image from Corcoran et al., 2026
dorsal fin lepidotrichium 6 increased thickness, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 7 with image from Corcoran et al., 2026
branched caudal fin ray bifurcated, abnormal hoxa13aot1013/ot1013; hoxa13bot1014/ot1014; hoxd13aot1015/ot1015 standard conditions Fig 4 with image from Corcoran et al., 2026
pectoral fin lepidotrichium decreased length, abnormal hoxa13bch308/ch308; hoxa13ach307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a standard conditions Fig. 3 from Nakamura et al., 2016
pectoral fin distal radial increased amount, abnormal hoxa13bch308/ch308; hoxa13ach307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a standard conditions Fig. 3 from Nakamura et al., 2016
pectoral fin proximal radial fused with pectoral fin proximal radial, abnormal hoxa13bch308/ch308; hoxa13ach307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a standard conditions Fig. 3 from Nakamura et al., 2016
Citations