CRISPR

CRISPR3-yap1

ID
ZDB-CRISPR-180608-2
Name
CRISPR3-yap1
Previous Names
None
Target
Sequence
5' - ACCTCATCGGCACGGAAGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns19 yap1
bns22 yap1
Expression
Gene expression in Wild Types + CRISPR3-yap1
No data available
Phenotype
Phenotype resulting from CRISPR3-yap1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-yap1
Phenotype Fish Conditions Figures
notochord yap1 expression absent, abnormal yap1bns19/bns19 control Fig. 2 with image from Kimelman et al., 2017
ectoderm yap1 expression absent, abnormal yap1bns19/bns19 control Fig. 2 with image from Kimelman et al., 2017
dorsal longitudinal vein truncated, abnormal yap1bns19/bns19; ci1Tg control Fig. S8 with image from Astone et al., 2018
mesencephalic vein truncated, abnormal yap1bns19/bns19; ci1Tg control Fig. S8 with image from Astone et al., 2018
hyaloid vessel decreased amount, abnormal yap1bns19/bns19; ci1Tg control Fig. S8 with image from Astone et al., 2018
posterior lateral line primordium EGFP expression spatial pattern, abnormal yap1bns22/bns22; zf106Tg/zf106Tg standard conditions Fig. 1 with image from Lardennois et al., 2026
posterior lateral line primordium EGFP expression decreased amount, abnormal yap1bns22/bns22; zf106Tg/zf106Tg standard conditions Fig. 1 with image from Lardennois et al., 2026
dorsal aorta mrc1a expression mislocalised, abnormal yap1bns19/bns19; wwtr1bns35/+ control Fig. 5 with image from Astone et al., 2018
caudal fin curved, abnormal yap1bns19/bns19; wwtr1bns35/+ standard conditions Fig. 5 with image from Astone et al., 2018
notochord undulate, abnormal yap1bns19/bns19; wwtr1bns35/+ standard conditions Fig. 5 with image from Astone et al., 2018
posterior caudal vein split, abnormal yap1bns19/bns19; wwtr1bns35/+; ci1Tg; nz101Tg standard conditions Fig. 5 with image from Astone et al., 2018
posterior caudal vein spatial deviation, abnormal yap1bns19/bns19; wwtr1bns35/+; ci1Tg; nz101Tg standard conditions Fig. 5 with image from Astone et al., 2018
posterior caudal vein morphology, abnormal yap1bns19/bns19; wwtr1bns35/+; ci1Tg; nz101Tg standard conditions Fig. 5 with image from Astone et al., 2018
epidermis morphogenesis process quality, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 6 with image from Kimelman et al., 2017
ectoderm separated from somite, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 11 with image from Kimelman et al., 2017
ectoderm anatomical region ab2-fn labeling spatial pattern, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 9 with image from Kimelman et al., 2017
ventral fin fold epidermal cell increased speed, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 8 from Kimelman et al., 2017
notochord posterior region ab2-fn labeling decreased amount, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 9 with image from Kimelman et al., 2017
pericardium edematous, abnormal yap1bns19/bns19; wwtr1bns35/bns35 standard conditions Fig. 1 with image from Kimelman et al., 2017
ectoderm decreased thickness, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 5 with imageFig. 6 with image from Kimelman et al., 2017
whole organism posterior region morphology, abnormal yap1bns19/bns19; wwtr1bns35/bns35 standard conditions Fig. 1 with image from Kimelman et al., 2017
somite shape, abnormal yap1bns19/bns19; wwtr1bns35/bns35 standard conditions Fig. 1 with image from Kimelman et al., 2017
ectoderm ecrg4b expression absent, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 3 with image from Kimelman et al., 2017
notochord undulate, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 1 with imageFig. 9 with image from Kimelman et al., 2017
notochord posterior region wu:fc23c09 expression absent, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 3-S1 with image from Kimelman et al., 2017
ventral fin fold epidermis morphogenesis process quality, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 7 with image from Kimelman et al., 2017
ventral fin fold epidermal cell shape, abnormal yap1bns19/bns19; wwtr1bns35/bns35 control Fig. 8 from Kimelman et al., 2017
epidermal basal stratum chromosome damaged, abnormal yap1bns22/bns22; wwtr1bns35/bns35 standard conditions Fig. 4 with image from Lai et al., 2022
ectoderm ab1-tp63 labeling decreased amount, abnormal yap1bns22/bns22; wwtr1bns35/bns35 standard conditions Fig. 1 with image from Lai et al., 2022
epidermal basal stratum cell apoptotic, abnormal yap1bns22/bns22; wwtr1bns35/bns35 standard conditions Fig. 1 with imageFig. 4 with image from Lai et al., 2022
epidermal basal stratum cell decreased size, abnormal yap1bns22/bns22; wwtr1bns35/bns35 standard conditions Fig. 5 with image from Lai et al., 2022
Citations