ZFIN ID: ZDB-CRISPR-180215-1
CRISPR Name: CRISPR1-dlx3b
Target: dlx3b (1)
Source:
Target Sequence:
5' - GGCGGACACTCGGCTCCTAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-dlx3b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-dlx3b
Genomic Feature Affected Genomic Regions    
Df(Chr12:dlx3b, dlx4b)tud70 dlx3b, dlx4b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-dlx3b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-dlx3b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-dlx3b
Phenotype Fish Conditions Figures
otic placode pax2a expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
neurogenic placode neuroblast neurog1 expression increased amount, abnormal tud70/tud70(AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
anterior lateral line ganglion tlx3b expression increased amount, abnormal tud70/tud70(AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
otic vesicle neurod1 expression increased amount, abnormal tud70/tud70(AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
otic epithelium stm expression decreased distribution, abnormal tud70/tud70(AB) standard conditions Fig. 2 with imageFig. 6 with image from Schwarzer et al., 2017
otic placode otog expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic placode atoh1b expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic vesicle hypoplastic, abnormal tud70/tud70(AB) standard conditions Fig. 2 with imageFig. 6 with image from Schwarzer et al., 2017
hair cell anterior macula myo7aa expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 4 with image from Schwarzer et al., 2017
otolith formation disrupted, abnormal tud70/tud70(AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic vesicle morphology, abnormal tud70/tud70(AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
hair cell posterior macula myo7aa expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic placode pax2a expression decreased distribution, abnormal tud70/tud70(AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
otic placode atoh1a expression absent, abnormal tud70/tud70(AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic vesicle hair cell decreased amount, abnormal tud70/tud70 ; s356tTg standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic placode GFP expression absent, abnormal tud70/tud70 ; s356tTg standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic epithelium stm expression absent, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic placode pax2a expression absent, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
inner ear absent, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic vesicle absent, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic placode sox9a expression decreased distribution, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
otic placode pax8 expression absent, abnormal tud70/tud70 ; foxi1em1/em1(AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
Genome Resources:
CITATIONS (1)