CRISPR

CRISPR1-dlx3b

ID
ZDB-CRISPR-180215-1
Name
CRISPR1-dlx3b
Previous Names
None
Target
Sequence
5' - GGCGGACACTCGGCTCCTAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
Df(Chr12:dlx3b, dlx4b)tud70 dlx3b, dlx4b
Expression
Gene expression in Wild Types + CRISPR1-dlx3b
No data available
Phenotype
Phenotype resulting from CRISPR1-dlx3b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dlx3b
Phenotype Fish Conditions Figures
otic placode pax2a expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
neurogenic placode neuroblast neurog1 expression increased amount, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
anterior lateral line ganglion tlx3b expression increased amount, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
otic vesicle neurod1 expression increased amount, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
otic epithelium stm expression decreased distribution, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with imageFig. 6 with image from Schwarzer et al., 2017
otic placode otog expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic placode atoh1b expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic vesicle hypoplastic, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with imageFig. 6 with image from Schwarzer et al., 2017
hair cell anterior macula myo7aa expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic vesicle morphology, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 6 with image from Schwarzer et al., 2017
otolith formation disrupted, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
hair cell posterior macula myo7aa expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic placode pax2a expression decreased distribution, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
otic placode atoh1a expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 5 with image from Schwarzer et al., 2017
otic vesicle hair cell decreased amount, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70; s356tTg standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic placode GFP expression absent, abnormal Df(Chr12:dlx3b, dlx4b)tud70/tud70; s356tTg standard conditions Fig. 4 with image from Schwarzer et al., 2017
otic epithelium stm expression absent, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic placode pax2a expression absent, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
inner ear absent, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic vesicle absent, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 2 with image from Schwarzer et al., 2017
otic placode sox9a expression decreased distribution, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
otic placode pax8 expression absent, abnormal foxi1em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB) standard conditions Fig. 3 with image from Schwarzer et al., 2017
Citations