CRISPR

CRISPR1-dlx3b

ID

ZDB-CRISPR-180215-1

Name

CRISPR1-dlx3b

Previous Names

None

Target

dlx3b (1)

Sequence

5' - GGCGGACACTCGGCTCCTAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
Df(Chr12:dlx3b, dlx4b)tud70	dlx3b, dlx4b

Expression

Gene expression in Wild Types + CRISPR1-dlx3b

No data available

Phenotype

Phenotype resulting from CRISPR1-dlx3b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-dlx3b

Phenotype	Fish	Conditions	Figures
otic placode pax2a expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 3 from Schwarzer et al., 2017
neurogenic placode neuroblast neurog1 expression increased amount, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 6 from Schwarzer et al., 2017
anterior lateral line ganglion tlx3b expression increased amount, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 6 from Schwarzer et al., 2017
otic vesicle neurod1 expression increased amount, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 6 from Schwarzer et al., 2017
otic epithelium stm expression decreased distribution, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 , Fig. 6 from Schwarzer et al., 2017
otic placode otog expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 5 from Schwarzer et al., 2017
otic placode atoh1b expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 5 from Schwarzer et al., 2017
otic vesicle hypoplastic, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 , Fig. 6 from Schwarzer et al., 2017
hair cell anterior macula myo7aa expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 4 from Schwarzer et al., 2017
otic vesicle morphology, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 6 from Schwarzer et al., 2017
otolith formation disrupted, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 from Schwarzer et al., 2017
hair cell posterior macula myo7aa expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 4 from Schwarzer et al., 2017
otic placode pax2a expression decreased distribution, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 3 from Schwarzer et al., 2017
otic placode atoh1a expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 5 from Schwarzer et al., 2017
otic vesicle hair cell decreased amount, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70; s356tTg	standard conditions	Fig. 4 from Schwarzer et al., 2017
otic placode GFP expression absent, abnormal	Df(Chr12:dlx3b, dlx4b)tud70/tud70; s356tTg	standard conditions	Fig. 4 from Schwarzer et al., 2017
otic epithelium stm expression absent, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 from Schwarzer et al., 2017
otic placode pax2a expression absent, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 3 from Schwarzer et al., 2017
inner ear absent, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 from Schwarzer et al., 2017
otic vesicle absent, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 2 from Schwarzer et al., 2017
otic placode sox9a expression decreased distribution, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 3 from Schwarzer et al., 2017
otic placode pax8 expression absent, abnormal	foxi1^em1/em1; Df(Chr12:dlx3b, dlx4b)tud70/tud70 (AB)	standard conditions	Fig. 3 from Schwarzer et al., 2017

Citations