Morpholino

MO4-nkx2.2a

ID
ZDB-MRPHLNO-080321-2
Name
MO4-nkx2.2a
Previous Names
  • nkx2.2a MO1
Target
Sequence
5' - CCGTCTTTGTGTTGGTCAACGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Start site morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nkx2.2a
Phenotype
Phenotype resulting from MO4-nkx2.2a
Phenotype Fish Figures
glial cell mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6Fig. S2 from Kucenas et al., 2008
glial cell bicellular tight junction absent, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. S2 from Kucenas et al., 2008
glial cell migration disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon decreased thickness, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon defasciculated, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon guidance disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
myelin assembly disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. S2 from Kucenas et al., 2008
myelinating Schwann cell mislocalised, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) Fig. 7 from Kucenas et al., 2008
oligodendrocyte differentiation decreased frequency, abnormal AB + MO4-nkx2.2a Fig. 6 from Kucenas et al., 2008
Schwann cell development disrupted, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) Fig. 7 from Kucenas et al., 2008
spinal cord has extra parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a Fig. 5 from Kucenas et al., 2008
spinal cord has fewer parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a Fig. 5 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu234Tg + MO4-nkx2.2a Fig. 7Fig. 8 from Kucenas et al., 2008
spinal cord oligodendrocyte cell fate specification process quality, abnormal vu234Tg + MO4-nkx2.2a Fig. 8 from Kucenas et al., 2008
Phenotype of all Fish created by or utilizing MO4-nkx2.2a
Phenotype Fish Conditions Figures
oligodendrocyte differentiation decreased frequency, abnormal AB + MO4-nkx2.2a standard conditions Fig. 6 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu12Tg + MO4-nkx2.2a standard conditions Fig. 7 from Kucenas et al., 2008
spinal cord oligodendrocyte cell fate specification process quality, abnormal vu234Tg + MO4-nkx2.2a standard conditions Fig. 8 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu234Tg + MO4-nkx2.2a standard conditions Fig. 8 from Kucenas et al., 2008
spinal cord has extra parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a standard conditions Fig. 5 from Kucenas et al., 2008
spinal cord has fewer parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a standard conditions Fig. 5 from Kucenas et al., 2008
motor neuron mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
glial cell mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6Fig. S2 from Kucenas et al., 2008
glial cell bicellular tight junction absent, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. S2 from Kucenas et al., 2008
glial cell migration disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
motor neuron axon guidance disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
motor neuron axon defasciculated, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
motor neuron axon decreased thickness, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
myelin assembly disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. S2 from Kucenas et al., 2008
Schwann cell development disrupted, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) standard conditions Fig. 7 from Kucenas et al., 2008
myelinating Schwann cell mislocalised, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) standard conditions Fig. 7 from Kucenas et al., 2008
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-nkx2.9 + MO4-nkx2.2a standard conditions Fig. 3 with image from Yang et al., 2010
spinal cord interneuron cellular quality, abnormal WT + MO1-nkx2.9 + MO4-nkx2.2a standard conditions Fig. 3 with image from Yang et al., 2010
lateral floor plate GABAergic neuron absent, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 5 with image from Yang et al., 2010
spinal cord interneuron cellular quality, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 3 with imageFig. 7 with image from Yang et al., 2010
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 3 with imageFig. 7 with imageFig. 8 with image from Yang et al., 2010
lateral floor plate Kolmer-Agduhr neuron cellular quality, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 7 with imageFig. 8 with image from Yang et al., 2010
Citations