ZFIN ID: ZDB-GENE-980526-76

Mapping Details

Gene Name: ELAV like neuron-specific RNA binding protein 3
Symbol: elavl3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 3 46,800,190 - 46,818,001
Ensembl 3 46,800,190 - 46,818,001
Vega 3 48,848,938 - 48,865,522
NCBI Map Viewer 3 46,798,511 - 46,817,871
UCSC 3 -
Mapped Clones containing elavl3
DKEY-223G14 Chr: 3 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 136.0cM elrc Mother of Pearl (MOP) Postlethwait, John H. Data
3 424.73cR zHuC Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
3 429.74cR elrC Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
3 433.83cR IBD1248 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
3 4007.0cR elavl3 Goodfellow T51 (T51) Geisler, Robert Data
3 82.0cM elavl3 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by elavl3
fb77b03Chr: 3 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 220,240 36.0
Forward Primer TGTTGTGTAGAGAGAGAAGAA
Reverse Primer AGGCTTGAAGGAAGGCCTAG