header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-41

Mapping Details

Gene Name: sonic hedgehog signaling molecule b
Symbol: shhb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 2 30,050,541 - 30,055,432
Ensembl 2 30,050,541 - 30,055,432
Vega 2 30,067,008 - 30,071,899
NCBI Map Viewer 2 30,050,547 - 30,055,381
UCSC 2 -
Mapped Clones containing shhb
DKEY-265A7 Chr: 2 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa2069 2 30,051,551 GRCz11 Busch-Nentwich et al., 2013
2 30,068,018 GRCz10 Busch-Nentwich et al., 2013
2 29,766,383 Zv9 Busch-Nentwich et al., 2013
sa5719 2 30,051,551 GRCz11 Busch-Nentwich et al., 2013
2 30,068,018 GRCz10 Busch-Nentwich et al., 2013
2 29,766,383 Zv9 Busch-Nentwich et al., 2013
sa8431 2 30,054,991 GRCz11 Busch-Nentwich et al., 2013
2 30,071,458 GRCz10 Busch-Nentwich et al., 2013
2 29,769,823 Zv9 Busch-Nentwich et al., 2013
sa25111 2 30,051,256 GRCz11 Busch-Nentwich et al., 2013
2 30,067,723 GRCz10 Busch-Nentwich et al., 2013
2 29,766,088 Zv9 Busch-Nentwich et al., 2013
la023573Tg 2 29,766,919 - 29,766,929 Zv9
la028783Tg 2 29,766,742 - 29,766,752 Zv9

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 113.9cM twhh Mother of Pearl (MOP) Postlethwait, John H. Data
2 2766.0cR twhh Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 450 36.0
Forward Primer GATATCGAATTCGACTGCTGCTGTACATT
Reverse Primer GGAAAACATCCTCCTGA