ZFIN ID: ZDB-GENE-051010-1

Mapping Details

Gene Name: Indian hedgehog signaling molecule a
Symbol: ihha
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 9 7,358,749 - 7,367,278
Ensembl 9 7,358,749 - 7,367,278
Vega 9 7,380,358 - 7,388,887
Vega 9 7,379,428 - 7,381,093
NCBI Map Viewer 9 7,358,749 - 7,367,278
UCSC 9 -
Mapped Clones containing ihha
CH211-67P4 Chr: 9 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
hu2131 9 7,359,197 GRCz11 Busch-Nentwich et al., 2013
9 7,380,806 GRCz10 Busch-Nentwich et al., 2013
9 7,400,713 Zv9 Busch-Nentwich et al., 2013
sa30645 9 7,367,078 GRCz11 Busch-Nentwich et al., 2013
9 7,388,687 GRCz10 Busch-Nentwich et al., 2013
9 7,408,594 Zv9 Busch-Nentwich et al., 2013
sa34554 9 7,367,171 GRCz11 Busch-Nentwich et al., 2013
9 7,388,780 GRCz10 Busch-Nentwich et al., 2013
9 7,408,687 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 51.1cM hha Mother of Pearl (MOP) Postlethwait, John H. Data
9 492.0cR ihha Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 545 MseI 36.0
Forward Primer CTTAACTGCAAATACGTGTGAATG
Reverse Primer TCTTGTTGAACCTGCTGTCG