Genomic Feature

tz288

ID
ZDB-ALT-980413-526
Name
tz288
Synonyms
  • AZ088B (1)
  • tz288b
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 9: 21379262 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A in Exon 11 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Leu>Stop at position 260 (1)
Sequences
Flanking Sequence
AATACCTCTCTCTTTCCATTTGGTGAAGCTTATCATTCTTTATAGCTTCAATCACCATGTTTGCATGAGGGTCGTCCTGTAAAAAAATATACAAAATTAAGGCATGAATTATTTTACAGGTATAACTAAGGAGCATTTTACCAAAACGCTCACATTAGGTGGGATATACTTGTCATCATCGTCAACTCCAAGGGGCACACAAATGAGTTTTTGAAAAGCTTTCTTCATCCTCTCACGGTCTCCAATGGCATAGTAGCACAGGATGAGGTTGAAACCTGTCTTTATGTTAGGGCTCTCAGTCATGATGTACTCAAAGGATGTGATGGCGTCTGAGTACTGGCCCATGTGTATGAACACAACTCCAATGTTCTGCATGATCTTTATCCTACAGAATAAAGAAATAAAATCACTTATCACAATCTGCAACACACATATAGTTTATAAAACAAATGCACTAAAGTACCAACCTCATTGCATTGTGGGCATTTGAAATCTGATCC
A/T AAGCCATGCGATAAAATTTAATAGCCTTTGTATAGTTCTTTTGCTTGAAATATATATTTGCCATGTTCACTTTTAATCGCCCTGTAGTAGACAAAAATGATTACAATCGAACATTAGAACACAGTTATGTTAAAGTGAAGTGAATAGAGTTAGTTCAAAGGAAGTTTAATCCAAGACACTGACTGGTTTATTAAGAACTTCAAACATGGCTCATCTAAAATGTTGTAATTAGCAAATGAGGCGTTATATGCACTAATTTGCATACATTTATAGTAAATAAATCTTTACATTGGGAGTCGGGTTTAAAATTTGGCATTTAATTGGATGCCTAGGGGATTTGGGAAAGTTTATCACTACATAATTAAAAAACAAAAATACTGCAAACATTTTTACAACATTTGTTCAGTAAAATGTTTATACGATTAGAGATTTTTAAATGAGCATATCACTTTTAAAACACTCAAAATAGGCAATCCTGCACCATGAATCCAGTCAAAAGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
tz288.pdf
Citations