Genomic Feature

tf215a

ID
ZDB-ALT-980203-809
Name
tf215a
Synonyms
  • AF15A (1)
  • mfn (1)
  • mini fin (1)
  • tf211
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 20763897 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop at position 544 (1)
Sequences
Flanking Sequence
GTGACAAAACTCCTGTTTTTTCAGAGCATGGTATGGTCCAAGTGCTGTTCTTGTTGTTTTCCTGTTGACTGCGGATGTTTTCCTGAAACATTCAGTTTAGGCTAAGCATCCGCATGTTTGAGTCAGGCAGTCGGATGCACCTGTGTGCACACACACACACTCTTACCTTCACAGCTCTTCTTGTCAGGAGCCAGTTCATATCCAGGATCACATGCACATTTGAAGCTTCCTAATGTGTTCACACATCTCTGTTCACAGCCTCCATTATCTGGCTTCAGACACTCGTCTTCCTCTGTTTTAATGACACAGACACAGAGTTACATCAGATGAATGGATGAGAGCCAACACATCTGCACAATGTGTGCGTGTGTGTGAGCGTGTACCTTTGAAGAAGTTTGCAGCAAAGCCTGCTTTATTAACAGTCCCATCAGAGACAAATTTCATCCAGAGGTTGTTAGAGGTAGAACGAATATCTTCAGGTTTATCATAGCCGCAGAATC
G/A ACCAATCAGAGGGCTGTTCTCTGACAATCCATCTCTAACCTCCAAATAGTCGTATGCACAGCTGTCATGCCTCTCGATCTGCACAAACAAAGGCATAATACACTAAGTGTTAATGGCATTAGCATGTCTTTGGCACCTTAGGTGTCAGTGCTAGGAAACAATCCAAAGAAAACAGGATCTCAGGCGTCTCTTATAGTATAAGCCAGGCTCTTAGGTCTGCTACACGTCCTGCTCTTTATAGATTATATGCGTGCAAAAGAAAGTGTGATTGTGTGTATGCAAAGGCAGAGAGTGTGTTTTCGTTTCCTCTGAACAATTCGACACCTTTGACCCACTGACACACACAATGGTGTGCATACATAGTTATGACTTGTAACGACATTCTGACGTTTAAATGTAAATAATCAAACGTGACTGTCTTGTGGTCTCACGTACCTGCAGGCTCATGGAAAATGGGGTTAAAATGCATCTATAAGTGTGTATATACCATAAGAATAAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations