ZFIN ID: ZDB-ALT-980203-363
Genomic Feature: th241
Synonyms: AH41C (1), th241c
Affected Genomic Regions: atoh7
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 13: 25449886 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Pro at position 44 (1)
FLANKING SEQUENCE (GENOMIC)
GCATGCACTTTTTAATTAGGTAATGGTCCTTGCCACCCGGCGCTGGTTGTGGCCAGATGGTAAGTTATCTCTGGTTTGTAACGCCTGTTTTCAGTGATAGAGCAGCCAAAGTTAATTGGAATGTCATTAAAGTTTGAGTTACTGGGGGTTGGGGCTGGACTGCACTAGTCCTGCTGTTGGAGATGTGCGTTTCATTAATAATAATGGATGTTTGGATGGAGTAATAAGGGTGGGGCTCCACCTGCTGCCACCTGTTAATACTCTATATAAGCATCGCTCATCCTTATGGCAGAACAGAAGCGATTAAGAACCATCCGGAATTACATCCCAAGAACATCGGTGACATTTTTGGAGACTTTTTTGAAGAGCCATGAAGCCCCGCAGGCCGAGCTGTGCAGACTCCGGGTCTGATTCTGATTCCAGAGACCCGGAGAAGTTTGAGAGTGCTATGCGGCGCAGGATGGCGGCCAATGCAAGAGAACGAAAGAGAATGCAAGGCC
T/C
GAACACGGCATTCGACCGGCTTCGGAAAGTGGTTCCACAGTGGGGTCAAGACAAGAAGCTGTCCAAATACGAGACCCTACAGATGGCTCTGAGCTACATCATGGCCCTCAATCGGATCCTGAGCGACGCTGGTAGACACGTGGATCCTCAGAAAGACTGGCTTAATTTACAGTTCGACGGCCTACAGACTGAGGGATATTTTATGCACTACGATTCACCTGTGGAAAGTGACTGCATGCTTTCTTCTTTCTCCTACCACTACGAAAGCCTCTGAAGTGACTGACTGATGGAGCATTTACTGTATCTTTCTTTATGTGGATACAGGAGGGTGTAAATATGTTTGTATTACTATGTAATATTTTATGTTCATGCTTTAATGGAGTCTGAATCATTCTAGTGGTATACAGGGTGAGGAAAAAGTACGTTTTTGTGCAATTGTAGAAAATCTTCCATTGGGCGGGTTGTGAATGAGGACTTAAAAGCGCATTTGTTTATGAATC
OTHER th241 PAGES No links to external sites

CITATIONS  (35)