Genomic Feature

te273

ID
ZDB-ALT-980203-1237
Name
te273
Synonyms
  • AE073A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 54617418 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Arg>Cys at position 167 (1)
Sequences
Flanking Sequence
TCTGCCGCAATTGAGCAGCCCCCAGCAACACAGGACCCTCAAGAACTCCTTCCTCATGTCCTTACTCCGCAAGGTGTAGATCAACGGGTTCAGTGCCGAATTCAGTGTGGCAAAGCTGAAGAAGATGCCAGCGTTATTGAGGATAGGGCATTGCTTCATCTTGCAGGAAGTGTCCAGGAGGAGGATGGTGAAGGCAGGCAGCCAACAGATGATGAAGACGCCAAGGACAATTGTGACCGTCTTCAGGAGAGCATACGCTGGAGAATTGGTGGCCTCTTGGTGGCTGGTGCGCACAATGAGATAGATGCGAACGTAAAGGATCACGATGGACAGCAAGATGATGCTAAAGATGGTGACAACAAACCGGATGTAGTATCGGGTGTTGAGGGGCAAAACAGCTGAGCAATCATCCAGGTTATTAATACAGTTCCAACCTATAATAGGAAGACCTCCTAGAAGAATGGACATCACCCAGCATGCTCCGATCAGAAGAAACATGC
G/A GCACGTTTTGTTGGATCCGTAAACCTTGACCTTGGTGATGGCGATGTAGCGCTCGATAGCAATAGCCAGCAGGCTGAAAACGGAGGCGGACAAAGCAATGAAAGCAGTCCCCTCTCGTATGAACCACTGGACAGGAGTCAAATGAAATGTCCTAGGGCCAGACAGGAAGATGTTGGCAATGTATGCAGAGCCAGCTAGTAGGTCCGAGAAGGCCAGGTTCCCAATGAAGAAGAACATGGCTGAGTGGAACTTTTTATTCCTAAACACAGCGATGAGCACTAGGAGGTTTTCCAAGATGATGATGCTGCAGATTACGACAAATAAAATGTTCAGGGAGCTCAAGCTTTGTTTGCTCTCGATGCGGTCTCTTAGTTCCTCTGCGGTCATCTCCTTAGCAGTGAGATAGTGGACCTGGATGAGGGTCTTGTTGAAGTACTGGGAGTATTTGCTCATGGTGACAGCTTGGCAAAACCCCGCAAACAGACGGCAAGTAGTCATTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
te273.pdf
Citations