Genomic Feature

w243

ID
ZDB-ALT-210527-19
Name
w243
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Kimelman Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Delins
Variant Location
Chr 16: 20896271 - 20896290 (GRCz11) (1) Details
Nucleotide change
TCCTGCACGCAACCCACCAC/AGAA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted / 20 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Elongated Polypeptide (1)
Sequences
Flanking Sequence
CGTTATCTCTAGTTTAGACGTTTATCAACCTCTTTGCATGTCACGTGCCTGCTCTCGTCCAATAACAGTTGGATCCTGACGCACGCGGGGCGCATGGGTATCTGTTACTCCACTGATCCACAGCTTCTCTTTCAGTCTTGGGGAATTCTAAAAGAGCTGCTGGGCTCCATGTAGGGCGTGCTATGACAGCGTCTTTACTCCTCCATTCCCGCTGGATTGACCCGGTGATGTTTCTCTATGACAACGGTTTGGATGATATGAGCAAAAACATGGAAGGATTTGTGGGAGGCAATTTTGCTGCGAACCAGTGTAGGAATCTCATTGCCCATCCGTCTACTTTGGCTCCGAGTACAACCTACACATCGAGTGAGGTGCCAGTGTCGGGCATGGGAGAGCCTGTCAAACAATGCAGCCCGTGTTCGGCCGTGCAAAATACCCCAAGTGCTTCTTTGCCCTATGGATATTTTGGCGGCAGCTATTACCCGTGTAGGATGCCCAAG
TCCTGCACGCAACCCACCAC/AGAA ATATGGAGAAAAATACATGGACACTTCTGTTTCTGGAGAGGAGTTTCCTTCTCGAGCAAAGGAATTTGCTTTCTACCAGGGCTACTCGTCTGGCCCTTACCAGCCTGTACCAAGTTACCTTGACGTGCCAGTTGTACCTGCGCTGAGCGCTCCTTCGGAACCGAGACATGAATCTCTACTGCCTGTGGAAACGTACCAGCCGTGGGCAATCACTAACGGGTGGAGCAGTCCAGTGTACTGCCCGAAAGATCAAACACAGTCAAGTACCTTGTGGAAATCGTCTATCCAAGGTAAAATGCTGCATCTCTGCTTTATTGCCACAAATAAATCGTTCACAAATGCTTAAGCATAAAAAAGTAACCTTTAGGCCCTGAGAAAAACGAGACTATCTAATAGTTATTTGAAACTGATATTTAAAAAAGAATTAACTTGATATTACTAATTCTTAATGTTAAAAGTAGACTGAAAAGGTTTGTGATTCACAGCAGTTCCTACAACAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations