Genomic Feature

zf1064

ID
ZDB-ALT-180718-4
Name
zf1064
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 5: 24524531 - 24524791 (GRCz11) (1) Details
Nucleotide change
CCTAAATTGGATTCTTGCTGGCTATACTTTTAGTAATTGTTAAATATAATTATTTTTTTATTTGATTTTTAAGGTCGTGGTCGACCGCCAACTGAGCCATTACCTGATGGGTGGATCATGACATTCCATAACTCCGGCATTCCAGTCTACCTCCACCGGGAAACCAGAGTTGTAACCTGGTCTAGACCTTACTTCCTTGGAACAGGAAGCATTAGGGTAAACATTTTGACTTGCCTAAGATATGACACTTACTGTAAATTG/AAACCCTAATTAAACC
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
16 bp inserted / 261 bp deleted in Exon 4 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTACAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGTTGGAACTAAACTGTGCAGGGCTTCGGCCCTCCAGGAATTGAGTTTGAGACTCCTCTACGCCTTGACATGAACGTGCAAAATGAGGGGTAGGGGTGAGGGGAAGGGCTAAGGGGTAGAATTGGGATTGGGCCATAGTCTGAAGCAATGGCAAATATTGAAAATATATATATTTTATAATAATACAGTTTTTACGATAACCTTTTTTTTTGGCCGATTTAATACATGCATGCAGAATAAAATCAGCAATTTCTGAAAAACAATCTTTTAAAGCAGGTGGATGTCTTGAGTCAGACTCGAGAGGAGTATTTTTTTATTTGGTAGAAAATGCATTTTTAGAATTTTTATTTTTTATATCTACAACTTTTATTGCTTTTAGTTTGACAATAGCACAAAAACCGAAAC
CCTAAATTGGATTCTTGCTGGCTATACTTTTAGTAATTGTTAAATATAATTATTTTTTTATTTGATTTTTAAGGTCGTGGTCGACCGCCAACTGAGCCATTACCTGATGGGTGGATCATGACATTCCATAACTCCGGCATTCCAGTCTACCTCCACCGGGAAACCAGAGTTGTAACCTGGTCTAGACCTTACTTCCTTGGAACAGGAAGCATTAGGGTAAACATTTTGACTTGCCTAAGATATGACACTTACTGTAAATTG/AAACCCTAATTAAACC CAATTAAACAATTACAATGTTCAATTTATTTTTTCACGCTCCTCATCTCTATTCTCTTATTTTCCCCTAGAAACATGACCCACCAACCAGTAGCATTCCCTGCCTGCACTACAAGAAAATGAAGGAACAAGAAGAAAGGGAACAGAATGGAGAGGTGACTCCGACAGCGGAGATTTCTCCAGTCAAATCTGGGGAGGAGGGTATCTCACTGGAGCGAGCCGATGAGCCTGACTCCACTGCCACTGAAGAGCCCACCGGCAGACCAACATCAGAAGATCCGGATCTTGACCTCATGGAGCCAGGAGGGTCTTCTATAGAGGGGAAGGATGGCCAAACCGGGGATACTGCACAGGGAGCATTGGGCCAGGTCAAAGCCAAGGTGGAGGTCTGCAAAGATGAGTCTATTGGTAAGTGGACTTTATACTTATAATTTTTTTATATATACAATAATCAAAATTTGCAGAGGATTAAAGCCTTTTAAAGTTTTCATAAAATTATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations