Genomic Feature

t23877

ID
ZDB-ALT-100802-2
Name
t23877
Synonyms
  • IG430NA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
Homozygous viable.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 23: 25268695 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Gln>Stop (1)
Sequences
Flanking Sequence
TCTAATTATGCGAGAGTAAAGTTGTGATGCATAATGATGTAGGCATTAAAACAGAAGCTAATGTAAAAACTAATGAACAGAAATGCAGAGGATGAACAAAACAAAATGCACTTAAAAATCTTCCAGTGAAATTTAATCTTCTGGATATTGACGTCATCGCTGCAGCACAGTATATTATGTGTTTGTGTTTGTGTCTAGCATCGGCTACACATTAAAACCAAAAGATGCTTTTGGCTTAAGTTCTTAATGGAAACCACTCTTCCTTTATTCTTCCTCGATTTCTCATTGATTTCATTCTTCACACCAGGCCATTCTCTTTGTTGGTGATGAAGATTCCCTCCCTCACATCTCTAGGACTGCGCTCCTTGCGGGAGATCAGCGACGGCAGTGTATACATCACTCAAAATATGAACCTGTGTTATCACCACACCATCAACTGGACACAGATCTTCCCACGTAACCAATTGCAACGCAGACGTAACGACATCAAGGAAAACAAA
C/T AAAAGATCCAGTGTGGTGAGTTAAGTTCAGCTCAAATAACTTACAGTATCAGTTAGCTCTTCCCCTCTATTGCGAATGAGCCAATGGCAGTTGAGTACCAGTTGCACAGAGAGCAGAACTCCCGCATCTTCGGATTTGGTGATGTTTGTGCTGTAGTAATAGTTCTACATTGTGCCTGAGGCATTTCTAACACAGATTCCAGGTATCCTGAGAGTATGGTCAGGGTTTGTCCCTTCAAAAATTCATTTCAATTTATTACCAAAACAAGTCAGTTAGCGTCACCTAAATCTGTTTAATCACATTGGTATGTAGAAACACATCATCTGCCTCAGGTAAGTTAGATAGTAAGCACTAAATTTAGCTAGCTCATGCTTCATTTATTCATTCATTCATTCACTTTCTTTCAACTTAGTTCCTTATTTATCGGGGGTCGCCATCGCAGAATGAACCGCAAACTATTTGAGCATATGTTTTTCACAGCGGATACCCTTCCAGTCGCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations