ZFIN ID: ZDB-ALT-000821-2
Genomic Feature: b641
Synonyms:
Affected Genomic Regions: smo
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Westerfield Lab
Location: Chr 4: 14973999 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Gly>Arg at position 242 (1)
FLANKING SEQUENCE (GENOMIC)
TAGTGGAGTGAATCATGTATAAAGTTTAACAAATTTCAAGCATTGATAAATACAATAGACAAAAGAAAAACTAAATAAACACTGCTTTATGATATTCTGGGGAGTCTCTTACAGTATTCAGGTTCAAATACTGAATAGTAAATGTAAAACAACACACTAGTCTTCATTGCATAAATATTAAAAAATTATATCTTTGTTAAACTTACAAATGGTACAACTTCTTGTGCCTGAACGCTTTAAACTTCCTCTAACATTGCTCCAACATCACATTGTTCTATAAAGCAGTCATTTACATTGTTGTTGGGGAAACATTCGCCTGGCTGACTTCCTGGTTTCCAGTATTTTTGACAGAAAGTAGCTGAAGTTTTGGCCTGGAGATTCTAATATTGAACGTTGTTCCTTCTTACAATTTCCAACAGGCCACATTTCTTGCAGACTGGAAGAATTCCAACCGTTACCCCGCTGTGATCCTCTTTTACGTCAACGCCTGTTTCTTCATT
G/A
GAAGTATTGGATGGCTCGCTCAATTCATGGATGGAGCCCGCAATGAGATAGTATGCAAAAGCGACAACACTATGCGACTTGGAGAGCCATCGTGAGTAAAAAATCCACCTTTCAAAAAAATTGAATAACAGTAAATTAGAGTTATACATTTTACAGTCAGCAAATTAATTATCATGGACAATACTAACAATATAATCAGTACTTACTCAATTTTTGGGATGCAAAAAACGATTTTCAAGAGGCTTGTTTTTCTTCTAGATCCACCGAGACGCTGTCATGCGTGATTATCTTCGTCATTGTGTATTACTCGCTTATGTCTGGAGTTATTTGGTTCGTTATGCTCACTTATGCCTGGCACACATCATTCAAAGCCCTTGGCACCACCCATCAGCCTCTGTCTGGAAAAACGTCCTATTTCCACTTGGTCACGTGGTCTATTCCTTTTATACTGACCGTTGCTATACTGGCCAATTCACAGGTGAGACAACTCTTACACTTTT
(1)
OTHER b641 PAGES No links to external sites

CITATIONS  (110)