Transcript

rps4x-004

ID
ZDB-TSCRIPT-160919-171
Name
rps4x-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000064049 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000064049 ZDB-TSCRIPT-160919-171 cdna: chromosome:VEGA67:7:51360237:51364567:-1 gene:OTTDARG00000020280.3 gene_biotype:protein_coding transcript_biotype:retained_intron gene_symbol:rps4x description:ribosomal protein S4, X-linked
CAACATGGCCCGAGGACCGAAGAAGCACCTGAAGCGTGTC
GCAGCTCCTAAACATTGGATGCTGGACAAACTCACCGGAG
TGTTCGCTCCTCGTCCCTCCACTGGTCCCCACAAACTGAG
GGAGTGCCTGCCCCTCATCATCTTCCTAAGGAACCGTCTC
AAGTACGCTCTGACTGGAGATGAGGTCAAGAAGATCTGCA
TGCAGAGGTTCATCAAGATCGATGGCAAGGTCCGCACTGA
CATCACCTACCCCACCGGCTTCATGGATGTGGTCAGCATC
GAGAAAACTGGAGAGAACTTCAGGCTGATCTATGATGTCA
AGGGACGCTTTACAGTTCACCGCATCACCAATGAGGAGGC
CAAGGTGAGCTTAATGATCTTCTGTGATCCAGGTTCCCAT
GGGTCATGGTGTTTTCTGGAATGTCCTTAAGTTTAAAAAA
GTTTAATCCAGACATTTAAAAGTCAGGATTTTAATTTGTC
CAAGTTACGGAATTTGTTTGTCATTTTCATTTCACGTCCT
ATTTATCATCTTGCCATAAAATAGCCGAGTGTTGCAAATG
TAATGCGATAAACTCAAACTTGCCATTTATCAAAATGTAT
TATTTCTAAATCTTGTTTTTAACGTTGTTTCACATGTTTT
GCTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations