Transcript

rps4x-202

ID
ZDB-TSCRIPT-090929-8059
Name
rps4x-202
Previous Names
  • rps4x-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025310 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025310|OTTDARG00000020280|ZDB-GENE-040927-19 rps4x|OTTDARP00000020826 rps4x-001 LG_ CR318655.9 Danio rerio protein_coding KNOWN, 911 bp
GGCTCCGGTAGTTCAGCTTATCTTCCGCTGACAGGAAGTG
GCTGGTCCTTTTCCGCAGACTCCAACATGGCCCGAGGACC
GAAGAAGCACCTGAAGCGTGTCGCAGCTCCTAAACATTGG
ATGCTGGACAAACTCACCGGAGTGTTCGCTCCTCGTCCCT
CCACTGGTCCCCACAAACTGAGGGAGTGCCTGCCCCTCAT
CATCTTCCTAAGGAACCGTCTCAAGTACGCTCTGACTGGA
GATGAGGTCAAGAAGATCTGCATGCAGAGGTTCATCAAGA
TCGATGGCAAGGTCCGCACTGACATCACCTACCCCACCGG
CTTCATGGATGTGGTCAGCATCGAGAAAACTGGAGAGAAC
TTCAGGCTGATCTATGATGTCAAGGGACGCTTTACAGTTC
ACCGCATCACCAATGAGGAGGCCAAGTACAAGTTGTGCAA
AGTGAGGAAAATCCTCATCGGCACAAAGGGAATCCCACAC
CTGGTGACCCACGATGCCCGCACCATCCGTTACCCTGATC
CTCTGATCAAGGTCAACGACACCATCCGCATTGACCTGGA
CACAGGCAAAATTACAGACTTCATCAAGTTTGAGACAGGC
AACATGTGCATGGTGACCGGAGGTGCTAACTTGGGGCGTA
TTGGTGTGATCACCAACAGAGAGAAGCACCCTGGCTCTTT
CGACGTTGTGCACGTTAAAGACAGCATTGGCAACAGCTTT
GCCACCAGGCTCTCCAACATTTTTGTCATTGGCAAGGGCA
ACAAGCCATGGGTGTCCCTGCCCCGTGGAAAGGGTGTCCG
CCTGACCATTGCTGAGGAGAGAGACAAGAGACTGGCTGCC
AAACAGAGCAGCAGCTAAGTCAACAGGACTAGCACACCTT
GGTTTCAAATAAAACAAAACTATTTACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations