Transcript

rps4x-002

ID
ZDB-TSCRIPT-090929-8060
Name
rps4x-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025311 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025311|OTTDARG00000020280|ZDB-GENE-040927-19 rps4x|no_translation rps4x-002 LG_ CR318655.9 Danio rerio protein_coding KNOWN, 733 bp
TGCATTTCATTCACGATACCCTCCCTAAATAATCCACAAT
CATCAACGTTTTAAAAGATCAGCTTTCTCCAATTAGCTCA
AAATGTTGCACATTCACCCCATCTAAGTTGAACAACACAC
ACATTTTGATGAAAAAGAGAAGATGTGATGATTAAAATGT
TAAAGGAAAACGCTTAGCTCCGCCGCTGTCTGACACTAGC
GGCAAAGCAGACTCGCGCTTCTCGATCATGTGAAATGTCG
TTTTAAGTATGGTTCGGCGGTCTTATATGTAATTTGTTCA
ATAGAGAGTTGGATTTATACAATAAGTGCTTATTTAAAAA
TGGCATAACTTCAGTAGTTTTTAAGTCGCTAGGAGAAGCT
AACGCTAAAGGCCTCGCCGTACTATCTTTGAGGCCCGAGG
ACCGAAGAAGCACCTGAAGCGTGTCGCAGCTCCTAAACAT
TGGATGCTGGACAAACTCACCGGAGTGTTCGCTCCTCGTC
CCTCCACTGGTCCCCACAAACTGAGGGAGTGCCTGCCCCT
CATCATCTTCCTAAGGAACCGTCTCAAGTACGCTCTGACT
GGAGATGAGGTCAAGAAGATCTGCATGCAGAGGTTCATCA
AGATCGATGGCAAGGTCCGCACTGACATCACCTACCCCAC
CGGCTTCATGGATGTGGTCAGCATCGAGAAAACTGGAGAG
AACTTCAGGCTGATCTATGATGTCAAGGGACGCTTTACAG
TTCACCGCATCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations