Transcript

rps4x-003

ID
ZDB-TSCRIPT-090929-8061
Name
rps4x-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025312 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025312|OTTDARG00000020280|ZDB-GENE-040927-19 rps4x|no_translation rps4x-003 LG_ CR318655.9 Danio rerio protein_coding KNOWN, 909 bp
CCTTTTCCGCAGACTCCAACATGGCCCGAGGACCGAAGAA
GCACCTGAAGCGTGTCGCAGCTCCTAAACATTGGATGCTG
GACAAACTCACCGGAGTGTTCGCTCCTCGTCCCTCCACTG
GTCCCCACAAACTGAGGGAGTGCCTGCCCCTCATCATCTT
CCTAAGGAACCGTCTCAAGTACGCTCTGACTGGAGATGAG
GTCAAGAAGATCTGCATGCAGAGGTTCATCAAGATCGATG
GCAAGGTCCGCACTGACATCACCTACCCCACCGGCTTCAT
GGATGTGGTCAGCATCGAGAAAACTGGAGAGAACTTCAGG
CTGATCTATGATGTCAAGGGACGCTTTACAGTTCACCGCA
TCACCAATGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAG
GAAAATCCTCATCGGCACAAAGGGAATCCCACACCTGGTG
ACCCACGATGCCCGCACCATCCGTTACCCTGATCCTCTGA
TCAAGGTCAACGACACCATCCGCATTGACCTGGACACAGG
CAAAATTACAGACTTCATCAAGTTTGAGACAGGTTGGTCA
GCTCATGGTTTTAAAATTGAGTGGAAACTGTTGTTCCTGT
ATTTGAGTTGCACATCACTTTTTCTGTTTGTGAATAGGCA
ACATGTGCATGGTGACCGGAGGTGCTAACTTGGGGCGTAT
TGGTGTGATCACCAACAGAGAGAAGCACCCTGGCTCTTTC
GACGTTGTGCACGTTAAAGACAGCATTGGCAACAGCTTTG
CCACCAGGCTCTCCAACATTTTTGTCATTGGCAAGGGCAA
CAAGCCATGGGTGTCCCTGCCCCGTGGAAAGGGTGTCCGC
CTGACCATTGCTGAGGAGAGAGACAAGAGACTGGCTGCCA
AACAGAGCAGCAGCTAAGTCAACAGGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations