Transcript

puf60b-003

ID
ZDB-TSCRIPT-160623-677
Name
puf60b-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063936 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063936.1|ZDB-TSCRIPT-160623-677 cdna: chromosome:VEGA67:7:40866548:40870500:1 gene:OTTDARG00000001873.4 gene_biotype:protein_coding transcript_biotype:retained_intron gene_symbol:puf60b description:poly-U binding splicing factor b
AGTCTCTGCTGTGTTTCTGTGCTGTTGCAGAGTTTTCAAT
GTGGATCACTACATGGCGGTAATAACGCGGAACACTGCGA
TCACTGTAAAATTGTGAGTGCTTTGCAGACAAGTCACTGG
CTTCACGACCCTGGTTGGCATATAAGGTTCGCCTCATAGT
GAGGCAAAGGTCTGATGATGGAGAATGGACAAGGCACAGG
GTCAAAGCTTGGATTACCGCCTCTTACTCCTGAGCAACAG
GAGGCGCTACAGAAGGCTAAGAAGTATGCCATGGAACAGA
GCATCAAGAGTGTTTTAGTGAAACAGACCATCGCCCACCA
GCAGCAGCAGCTCACAAACTTACAGGTGAGCTCATATGAT
GATCTAACTATGTAGAATACCATAAATGAATTTGTTTGTT
TGACCTTAAAACAATTGATGCTTTTTTGCAAACTAGTATA
TCTAAAGCTACATAGATTACCCACTGATTTGATCATGTAA
AGGGTTCAGTCTTTCATTAACATAAATCATACACAAGCCT
GAAAAACTGATCTTTTAGAATTTGATCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations