Transcript

puf60b-205

ID
ZDB-TSCRIPT-160623-229
Name
puf60b-205
Previous Names
  • puf60b-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063971 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000063971 ZDB-TSCRIPT-160623-229 cdna:known chromosome:VEGA67:7:40866576:40875226:1 gene:OTTDARG00000001873.4 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:puf60b description:poly-U binding splicing factor b
AGAGTTTTCAATGTGGATCACTACATGGCGGTAATAACGC
GGAACACTGCGACAAGTCACTGGCTTCACGACCCTGGTTG
GCATATAAGGTTCGCCTCATAGTGAGGCAAAGGTCTGATG
ATGGAGAATGGACAAGGCACAGGGTCAAAGCTTGGATTAC
CGCCTCTTACTCCTGAGCAACAGGAGGCGCTACAGAAGGC
TAAGAAGTATGCCATGGAACAGAGCATCAAGAGTGTTTTA
GTGAAACAGACCATCGCCCACCAGCAGCAGCAGCTCACAA
ACTTACAGGTGGCAGCACAGAGGCAGCGAGCTCTGGCCAT
CATGTGTCGTGTGTATGTGGGCTCCATTTATTACGAGCTG
GGGGAAGATACCATCCGGCAGGCCTTCGCACCCTTTGGTC
CCATTAAGAGCATCGATATGTCTTGGGATTCTGTCACCAT
GAAACATAAGGGCTTTGCCTTTGTGGAGTATGAGGTTCCT
GAAGCGGCTCAGCTGGCCTTGGAGCAGATGAACTCTGTCA
TGCTGGGTGGGAGGAACATTAAGGTGGGTCGGCCAGGTAG
CATTGGACAGGCGCAGCCTATCATTGAACAACTGGCAGAG
GAGGCACGTGCCTACAACCGAATCTACGTAGCCTCTATCC
ACCCTGATCTGTCTGACGACGATATCAAGAGCGTCTTTGA
GGCCTTTGGAAAGATTAAAAGTTGTATGCTGGCACGAGAA
CCCACCACGGGAAAGCACAAGGGCTTCGGATTTATCGAAT
ATGAAAAGCCTCAGTCATCGCTGGATGCTGTCTCATCCAT
GAACCTGTTTGACCTCGGCGGTCAGTATCTAAGAGTGGGC
AAGGCTGTTACTCCACCCATGCCTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations