Transcript

puf60b-201

ID
ZDB-TSCRIPT-090929-29
Name
puf60b-201
Previous Names
  • puf60b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002000 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002000|OTTDARG00000001873|ZDB-GENE-040625-116 puf60b|OTTDARP00000001769 CH211-12P8.2-001 LG_ AL772146.4 Danio rerio protein_coding NOVEL, 2136 bp
CTGTGTTTCTGTGCTGTTGCAGAGTTTTCAATGTGGATCA
CTACATGGCGGTAATAACGCGGAACACTGCGATCACTGTA
AAATTGTGAGTGCTTTGCAGACAAGTCACTGGCTTCACGA
CCCTGGTTGGCATATAAGGTTCGCCTCATAGTGAGGCAAA
GGTCTGATGATGGAGAATGGACAAGGCACAGGGTCAAAGC
TTGGATTACCGCCTCTTACTCCTGAGCAACAGGAGGCGCT
ACAGAAGGCTAAGAAGTATGCCATGGAACAGAGCATCAAG
AGTGTTTTAGTGAAACAGACCATCGCCCACCAGCAGCAGC
AGCTCACAAACTTACAGATGGCAGCAGTGACAATGGGCTT
TGGAGATCCTCTCTCATCTTTACAATCGGTGGCAGCACAG
AGGCAGCGAGCTCTGGCCATCATGTGTCGTGTGTATGTGG
GCTCCATTTATTACGAGCTGGGGGAAGATACCATCCGGCA
GGCCTTCGCACCCTTTGGTCCCATTAAGAGCATCGATATG
TCTTGGGATTCTGTCACCATGAAACATAAGGGCTTTGCCT
TTGTGGAGTATGAGGTTCCTGAAGCGGCTCAGCTGGCCTT
GGAGCAGATGAACTCTGTCATGCTGGGTGGGAGGAACATT
AAGGTGGGTCGGCCAGGTAGCATTGGACAGGCGCAGCCTA
TCATTGAACAACTGGCAGAGGAGGCACGTGCCTACAACCG
AATCTACGTAGCCTCTATCCACCCTGATCTGTCTGACGAC
GATATCAAGAGCGTCTTTGAGGCCTTTGGAAAGATTAAAA
GTTGTATGCTGGCACGAGAACCCACCACGGGAAAGCACAA
GGGCTTCGGATTTATCGAATATGAAAAGCCTCAGTCATCG
CTGGATGCTGTCTCATCCATGAACCTGTTTGACCTCGGCG
GTCAGTATCTAAGAGTGGGCAAGGCTGTTACTCCACCCAT
GCCTCTGCTAACACCTACAACTCCCGGAGGTTTGCCCCCT
GCTGCAGCTGTGGCCGCTGCTGCTGCCACCGCCAAGATTA
CTGCCCAGGAGGCTGTTGCTGGGACAGTGCTGAGTTCTCT
TGCCTCACCAGCTCACATTCTCAGTCAGCAAATGGGACTT
CCACAGGCTGTACTGGCTGCCCAGGCCCCTGGCATTATCA
CAGGTCTGTCCACCACGAAAACAGTTTTCCACCTGGTGGG
TTTGGTCAACCCAGTTCTGGCATCCCCACCAGTCACAGCA
CCTGCTTCTATGGGAACACCAACATCTGCAGTGCAATTGC
ACACAGAAGTGAAGAGAGAGGAAGACAGCAGGCGAACTGC
AGAAGATCACAGTGCACCGGTTGGCAATGGACAAGACAGT
GAACTGGAGCGTCTCAGCGTCAGCGCAAGTGCAGGAAGAC
AAGCGGCCATTCAGTCCAAGTCAACGGTTATGGTGTTGCG
CAACATGGTTGGTCCAGAGGACATTGACGATGACCTGGAA
GGGGAAGTGATGGAGGAATGTGGGAAGTACGGGGCTGTGA
ACCGGGTTATCATATACCAGGAGCGACAGGGTGAGGAGGA
TGATGCCGAGATAATAGTGAAGATCTTCGTGGAGTTTTCT
GATGCTGGTGAAATGAACAAGGCCATCCAAGCTCTCAACA
ACCGCTGGTTTGCAGGTCGCAAGGTTGTTGCCGAGTTGTA
CGATCAAGATCGTTTTAATAGCAGTGACCTCACTGCGTAA
GACTGTCCTGAAATGGCCACCTGTCCCATCTCTTGGCACT
CGATCAGCTTTCATCACCGCTGCTTGAGATCTGGGCCTCT
TTGAAACTTGTAATTATTTTTTTATTGATGTTGATAGTAA
TAATATTATTGGAACAAATCCCAACAGGGGGATTTAGCTT
AGGACAAAAGAACATGCTCCTCATACATTTACTTTGTGTC
ACCTACTGTGAAAGAATTGCATTTTTAACAGTCGTTATCA
TTTGCAGGGTTTTGTTTTCTAATTTTGAAAGAAAAAATGC
AATTTTCCCCATTCCTACCCCACTTTTTTACAAATGGCAA
CTTTGTTTCTCCACTGACATTGTGTTCAGACTCTAAACAT
TGTGTTGGTGACATTGGTTCTGGCTTTACCAAAACAATAA
ATTTCTCTAATATGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations