Transcript

lrig1-203

ID
ZDB-TSCRIPT-141209-817
Name
lrig1-203
Previous Names
  • lrig1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060960 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060960|OTTDARG00000042254|ZDB-GENE-031113-23 lrig1|OTTDARP00000047101 LRIG1-002 LG_none CR854847.7,CR339047.8 Danio rerio protein_coding KNOWN, 416 bp
GTGTGTATTATCTATCAGACCAGGAAGAAGAGCGAGGAGT
GCAGTGTAAACACAGATGAGACGATTGTCCCTCCTGATGT
TCCCAGTTACCTGTCCTCTCAGGGCACTTTATCAGAAAGA
CAGGACGTGTGTATACGAGTGGAGTCCAATGGGGGATCTC
AGCCCAATGGACGAATAGAAAGCAATGGCTACGATGTGCC
GGTCGTGTGCGCAGACTGCTTGGAAAACAGCACCAGCTAC
TCCAAACACTGTAACTACCTCCCTCACGATTTAGCGCCCC
CTTCAGGCATGGAGTATCAGCAGACGCACCAAACACCCAT
CTTTCCCACCAACCACGACAGGGTGACAATATCACCCTCA
TCAAACCAGTACAGTGACCGAAATGGATTGTTGGTGAACA
AGTCAGACACACCACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations