Transcript

lrig1-204

ID
ZDB-TSCRIPT-141209-3304
Name
lrig1-204
Previous Names
  • lrig1-004
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061101 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061101|OTTDARG00000042254|ZDB-GENE-031113-23 lrig1|OTTDARP00000047289 LRIG1-004 LG_none CR854847.7,CR339047.8 Danio rerio protein_coding KNOWN, 921 bp
CAGAGATTTGAGGAGTGCGCACCTTTTACCAGCCCCAGCA
CTGTTACTGTAGGCATCATCATCATCGCTGTGGTCACCAG
TATTGTGGTGACTTCACTAGTTTGGGTGTGTATTATCTAT
CAGACCAGGAAGAAGAGCGAGGAGTGCAGTGTAAACACAG
ATGAGACGATTGTCCCTCCTGATGTTCCCAGTTACCTGTC
CTCTCAGGGCACTTTATCAGAAAGACAGGACGTGTGTATA
CGAGTGGAGTCCAATGGGGGATCTCAGCCCAATGGACGAA
TAGAAAGCAATGGCTACGATGTGCCGGTCGTGTGCGCAGA
CTGCTTGGAAAACAGCACCAGCTACTCCAAACACTGTAAC
TACCTCCCTCACGATTTAGCGCCCCCTTCAGGCATGGAGT
ATCAGCAGACGCACCAAACACCCATCTTTCCCACCAACCA
CGACAGGGTGACAATATCACCCTCATCAAACCAGTACAGT
GACCGAAATGATTTCTGATCAAGTTATGCCAGATTTATTA
ATGTAGTGAATCATCTGATTTTCATCGAGCAGGATTGTTG
GTGAACAAGTCAGACACACCACTGTCACTGGAGGAGTCGT
ACCATCGGCCAGTAAAACTGCTGTCTGAGGACTGTGACAT
TGGGTCAGAGCTCACACAGACTCTATTACCCAACGGACAC
ACACACGCGCCCAGTTCAGCTCTAAACCAGAGCCAATCCT
TTAGGCGGGACAGTGACTAACGCCACACCAAGCCTCTTCT
TGACATCCTTTTGCACTGAGAACTGCTACCTCACACTGAG
GGGCGCAGAAAAAACCCGCCCCGATTTTCTGAACAGAATT
AGGGGCGTCCGGAGTTTGAAGGTTATAAAGCTTGAACGGG
GCGATGACGACGTCCCATACGAGCGTTATTGATGTATATA
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations