Transcript

lrig1-201

ID
ZDB-TSCRIPT-141209-3260
Name
lrig1-201
Previous Names
  • lrig1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060959 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060959|OTTDARG00000042254|ZDB-GENE-031113-23 lrig1|OTTDARP00000047100 LRIG1-001 LG_none CR854847.7,CR339047.8 Danio rerio protein_coding KNOWN, 7283 bp
CAGAGCCTGGCCGTCAATCATGCCCCAAGAGCCAATTGTA
AAGCAGAACGAGGGAATCTTTATCACTTCTGATGTATCCA
ACGTGGGACGAAGGAACGTCTGGATAAAAAGAAAGTAAAG
TCCGGGAGGGGGAAAACAAGCGGTGGAAACGGTTAGAAGT
GCGAGGTGAATTTGTAAATTATCAGAGTTTTCGGACCGTA
CAACGAGATCAAGATAAAAGCTTCCCAATTCCTTCAACCG
CGCGCTGGAAGGAGAGAGTGTACGAACGAACGAGAGAGCC
GCAAAGTTCACAACAGTCGGACGGCTTTACTGGAACTGTT
TCTCTTCAAAACTGTTTTATTGTTTTTACTTGACTGATCG
TGGAGTCGCAGTTTGGATACTTTGTAAGAAGAAACGAGAG
CCTCAAACTTTTTAAAGAGTGCGGTTTTCCCTGTGGAAAA
GTTTCTTTAAAGCGCCGATGATCCTAGATTTTCCTTCAAC
GCGCTCGTGTGGAGTTAATGGACACGATCTACTATGTGTT
TACTCTTCGTTATAATGAATCCCTTAGGATCAAAACATTA
TAAGAAGTTCAGAAACACCGTGGACAATTTAAACTCCTCA
AACTACATTTGATTCAGTGGATCGCTCTTGCCAAAACAAA
GCGCCCGTCTATCCCCCATACAGACCCCCTTTTCAACCTT
TTAAGGACAACTGCATTTAGTTTTGGCTACTGGACAAGTT
TCTTGTATTGCCTCGTCGTGATTCACCTTTGATTTACTTA
CGTGGTGCTGCAGAGGAGATTTTTTTTCAAACTGTGGGAC
TGTTTTCAAGTTCAGGGCAGATGCATTGCCCGAAAGCAAC
GCAGTATAATTTGATAGTACCGCTGGGTAAACAAACAACT
TAATGAAGGCGAATTACTCGAACTCTGAGAAACTCAATAA
GCTCGAGCTGTCCGTTTGTGGATGAGAGAGATCAGTCGTT
AAGCGCTGAGACAACTGGATACAAAATGGCGGCGTGGCTG
GGACAGATGGGATCACTTTCATATCATGTGTTTTATTGGC
TTTTGACGCTGGAACTGTTAATCAATTATGGCGCACCGTG
TCCTCAAAACTGTACGTGTACGCTTGATACGACCGACTGC
AGTCGTTTGGACATGACTGATGTCCCTCAAGACTTGCCAA
AGAGCACTGTGCATCTAAATCTGAGCCACAACAAGCTGAC
GGCAGTCGATATGGACATCCTCTCCAATCTGCCCCACCTG
AGAGAAGTGAGGCTTGACCACAATGAGCTGACATCTATCC
CTTCATTTGGAGATGCCGCAGCATCAGTTGTTACACTTCT
CCTGCACCATAATAGAATCCGCAGACTGGAGGGGAGTCTT
CTACAGAACTTCTCTGCTCTTGAGACGCTAGATTTGAGTA
ATAATGACATCACAGAGTTGAGAGAGCACTGCTTCCCTCT
GGGGTTACAAATCAAAGACCTGCACCTGAGCAGTAATAAG
ATCGTTCATCTGGAGTTCGGGGCATTTAAGAATCTTGCCG
GGAGTCTGCAGATCCTCAGATTGAGCCGGAACCGATTAAC
TCATCTTCCTGTTAAAGGCCTGGAGCTGCCCAAACTCACA
CAACTGGAGTTGAGTAGGAACAGGTTGCGGTTGATCGAGG
GACTCACCTTCCAAGGTTTGAGCAGTTTAGAAGTTCTCAA
GCTTCAGAGAAACAACATCAGCAAACTAACAGATGGGGCA
TTCTGGGGTCTGGCCCGGATGAGGGTTCTGCACCTGGACT
ATAACAGTCTACGAGAAGTGAACAGTGGCTCTCTGTATGG
TCTGGAGTCTCTGCTGCAGCTCTACCTCGCCAACAATTCC
ATCTCAAACTTTAACCCTGAGGGTTGGGGCTTTTGTGAGA
GACTTCGAGAACTGAATTTGTCTTATAATAACCTGACGAA
GTTGTCTGAGGGTAGTTTTGCCAAGCTGGTAAACCTGATT
TCCCTGCGTTTGGGACACAATTCCATCAGTCACATCACTG
AAGGAGCATTCAGAGGCCTTAGCTCCCTGCGCACACTGGA
GTTGGACCACAATGACATCTCTGGAACTATTGAGGACACC
AGTGGGGCCTTCACTGGCCTCGAAAACCTCAACAAGCTAA
CTCTGTTTGGAAACAAGATCAAGTCGGTGGCCAAGAAAGC
CTTCTCTGGCCTGGAGGCTCTGGAGCACCTGAATTTAGGG
GAAAATGCCATCCGCTCCATCCAACCCGAGGCATTCAGCA
AGATGAAGAACCTGCGCTACCTTCATATTCAGAGCGACAG
TTTTCTGTGTGACTGTCAGCTGCACTGGTTTCCAGATTGG
CTCCTCACTCGAGGGCTGAACCCTGGTGTTCAGGCCACAT
GTGCCCATCCAGAGAGCCTAAAGGGCACCAGCATCTACCA
AGCCCCACCACAGAGCTTTGTTTGTGATGACCTTCCCAAA
CCCCAGATCACGGTTCACCCAGTCACCACAGCTGCAGTAT
TGGGTAAAGACGTGCGTCTGACCTGTACTGCTGCCAGCAG
CAGCAGTTCTCCCATGACCTTCACCTGGCTAAAGGACCAG
GAGACACTCCGCCAGGCTGAGGTGGAGAACTTTGCCCATG
TGCGGGCCAGCGATGGAGGAGTGATGGAGTACACTACGAT
CCTTCACCTTCGACACGTCACCTTCAACCATGAGGGACGA
TACCAGTGCATCATCAGCAATCACTTCGGCTCCTCTTACT
CCAACAAGGCCCGCGTCACTGTAAACGTCCTGCCTTCGTT
CGTCAAGACCCCACGTGACATCACCATCCGCACAGGCACC
AAAGCGCGGTTGGAGTGTGCGGCCGAAGGGCATCCGACTC
CACAGGTGGCATGGCAGAAAGATGGCGGAACAGACTTCCC
TGCTGCCCGAGAGCGGCGCATGCGTGTGATGCCTGATGAT
GATGTGTTCTTTATCATGGATGTGAAGCCAGAGGATATGG
GTGTTTACAGCTGCACAGCGAAAAACACAGCAGGCATGAT
CTCCGCCAACGTCACCTTAACAGTGCTAGAGACCCCTCAT
CTGGCACAGGAAATGGAGGATCGTAATGTGGTGGTAGGCG
AAACTGTAGCACTGCAGTGCAAGGCTTTGGGCAGTCCACC
ACCTCGCATCACCTGGCTGAAGGGTGAAGAGCCTCTTCGA
GCCAGCGACCGTCATCACTTCACTCCAGGAAATCAGCTGT
TGGTGATCGGCAGCAGCACATTAGAGGATGCTGGACGCTA
CACTTGTGTGATGTCCAATACGCTCGGCACCGAACGTGCT
CACTCGCAGCTCACTGTCTACCAGAGATTTGAGGAGTGCG
CACCTTTTACCAGCCCCAGCACTGTTACTGTAGGCATCAT
CATCATCGCTGTGGTCACCAGTATTGTGGTGACTTCACTA
GTTTGGGTGTGTATTATCTATCAGACCAGGAAGAAGAGCG
AGGAGTGCAGTGTAAACACAGATGAGACGATTGTCCCTCC
TGATGTTCCCAGTTACCTGTCCTCTCAGGGCACTTTATCA
GAAAGACAGGACGTGTGTATACGAGTGGAGTCCAATGGGG
GATCTCAGCCCAATGGACGAATAGAAAGCAATGGCTACGA
TGTGCCGGTCGTGTGCGCAGACTGCTTGGAAAACAGCACC
AGCTACTCCAAACACTGTAACTACCTCCCTCACGATTTAG
CGCCCCCTTCAGGCATGGAGTATCAGCAGACGCACCAAAC
ATCAACTTTCACCAGCCTCAGCAATGAACCACACTGCAAC
GGCACTCCAAACGGCCTTAGAAAAGACAACCAAACACCCA
TCTTTCCCACCAACCACGACAGGGTGACAATATCACCCTC
ATCAAACCAGTACAGTGACCGAAATGGATTGTTGGTGAAC
AAGTCAGACACACCACTGTCACTGGAGGAGTCGTACCATC
GGCCAGTAAAACTGCTGTCTGAGGACTGTGACATTGGGTC
AGAGCTCACACAGACTCTATTACCCAACGGACACACACAC
GCGCCCAGTTCAGCTCTAAACCAGAGCCAATCCTTTAGGC
GGGACAGTGACTAACGCCACACCAAGCCTCTTCTTGACAT
CCTTTTGCACTGAGAACTGCTACCTCACACTGAGGGGCGC
AGAAAAAACCCGCCCCGATTTTCTGAACAGAATTAGGGGC
GTCCGGAGTTTGAAGGTTATAAAGCTTGAACGGGGCGATG
ACGACGTCCCATACGAGCGTTATTGATGTATATAGGTATA
AATCCTCCTCAGGGAGGCTTCATTCACACTTCAGAAATGT
GATTTGCATTTGACGCATGCAAAATATATGACAGAGTGCT
ATAACGTCGGGCTTGGAGCTGTACATAAGAGTTTTCATAT
ATAAAGATATGAATGTATGTATACTGTAACTTTTACAAAC
GAGTGTCGGACTATTCGGTGCATGGTGAGATCAGAGTGAT
TCTTGTTTTTTTTTAAGATCTCTCCTGCTTTTCCCAGTTT
TATAAGCAGTGCCTTATTGCCACAAGCTTGGTTTTTGTCT
GGAGATGTCGGTGTTGTGTTACCTTTCACAAAAATGGGAA
ATTTGTCACGCACTTGAAGTTAATATAAGTTTAAATTGGT
CGGATTATAGGAATATTCCAGGTTAAACATGAGATATTGA
GTACCCATGGTAATAAATAGGTGGTGAAAAAAGAACTAGA
AAAGTAATGAATATTAGGTCATTTTTTAAATTGTGAACAA
TTCCACAGTTCAGATTTGAGGAGGTCATTTGCCTTTTTTT
GGCATAGATACATAAAATAAATCAAACGAGACAGTAAATA
CGTTTTTACTGAAGGATTTAAGTTCTTTTGAACTTCTTTT
ACTTAAGTTTTTATTAAATAAATGTAGTGCTCATGAGTGT
TAATCTAAAAAACAAAAATAAACAGTCCTCGGATGCTCTT
TTATTCAATTAGTTTTTTTTTTATTTACTGACTTACTGTT
ACTAAAATATATGTTAGAAGCAATTATAATCAACAGTTTC
AACATATTTTTAAAATAACATTTTAACTTAACCCATAGTG
AATGGTGAGTACTTTGAGCACATACTTTTTAAAAAGTCGA
CTTGTGGCAGATTATTGCTTTAGCAGGAAAATGAAATGAA
AAAGTGCTTAATTGTTATAAACAAAATCCACGAAATATGA
GTTGAACATTTTATATGGAACCTCTATTTTTTTTAATATA
GAATTGAAATTGAAACTCAAAGCCCAAAACAAAAAGGACA
AAAGCGTCTGCTAAATGACAGTATGTTTACATGGACACCA
ATAATCCGATTTTAATAATTAAGACAATACTCTGATTCAG
AGTCTACCATGTAAACAGTGATTTTTGATTAATTTAATCC
AAAGGTCATAATCAAAATAAACAGAAATTGGAGTAAGATG
TGGAGTATGCTGATTTTATTCGAATTATTGAAGTGTAGTA
TTTAAACACCTAACAATCAACCTATTACCATCATGTAGGA
TTTTCGACGTATTTTGCAACAAGATAGTCTATACAGGCTG
TTTGACAATATTCTCTGCACCGACCGAGTCGGTGAAGGAC
CACAGATGCACACATTGTGAAATGCGGAGGTTTATTTGCT
CATACAGCGTGCAGTATCCCATTCCATTACAACTTCCATA
AGTTCATACTCGCATGCAACTTCATGTTAGAAACAGGGAC
ATGCATGAAATGTTCTTGAATGAAAGTGAAAGTGCCAATT
ACAGTTAAAGTCGACAAATTAAAAATTAAACGCCCGAAAT
AACATGAAACTCTGGAGGAAATGAAGATAGCGTGGTGACG
CGATGAAGGTAATCGAATTATGTGCTGACATGTAAAACGA
GATCATGAAAGAAACATTCATGAAGCAAATCACATTAAGG
CAAACAATCGATAACTGATGTCCATGTAAACGTAGACAAT
GTAAAATCGGAAAATTAAAGAGATTTGTTTACTTATTTGA
GTTTGACATCTCTAAAGATGTGCTTAGAGAGTAATTCATT
CATTTTCTATACGCCTATTTCCAATCAAAGAGCATCAGAG
GGTTTTTCTTAAATCTCTAGAATTGACGTTAATTGCTAAT
TGTAACTCAATAAATAATGAAAATTTACTATTAAAATAGT
TGTCAAGCAGTCTTAAAGTTAACGACACACACATTTACAT
GCTTTACCAAGACTCTCCATAGTAGTAATCTACTTTATAC
TGTAAAAACTGCTTGTTATATGGCCTTAACGTACCCCTAA
ACCCAACCCTTGGAGAAAACTGGTGGCAAATTTTGAATGT
TGAAAAACCCTGTTAAGTATTTTAAGCATTTTGAATGACA
AGGACACAAAACAGTCCTCATAAACCACCTTAGAGTACAA
CTAGTTCATCCCAACAAGTTTGCATTCATGTAAACCACAT
AAACAAGTACACACACACACACACACACAAAACAGATCAA
GTATTATATTTGCTATCAATATCTAGTGTTTAATCTGGAA
TATTCCTTTGCCGTAATATATACGCTGTGATCTGTGATGA
AGGAAGAGCTCCTCGTTGAATTTTCAGGTCTGTTATGGAG
CAGAAACTGAGAACATTGGCATGCGGGAAAATATAAGCAC
TTTGATGAATCTTACAAAAGCTGAACACTCTTACACCCTG
AAATTGTGCCGCAATCGAGCCTCTTCTGTTAACAAAGGTA
CACGCCACTACTATCTGAAATGAACTTCTTTTTAACACTT
GGGAAATATCACAACTATTAAATAATGAAACAGGGAGAGC
GGTTCTAACATTGACTTCTAGCTAACAACAAAACCATACG
CTGCCAAAACACAAAAGGGAAATAAATACGAGTCTCTAGA
AAGAGTCAAGCTGCATTTTGCATTCAGGGTTTTCCTTCAA
CTACAGAATGTCTTGGTGGAAAGGGAAAACAAAGCGTCAA
CAAAACATTATTAATTAGCCTGAGCCAAACAGGTTCATTT
TTAAAGCCCGGTTTCTTTGTTTTGTGTTTTTTTTTTTTTT
AACTAAAACATCTCTACTACTAAACTAGGGGAGTGTTTGT
AAAGGTAGATTACAGCGGATGCCAGTTTAACCCTAAAATG
TTTTGATACTGTGGTTAGCTGGCTATGCTAGCTCTGTGAA
GAAGGCCATAAACTGTACGGATGTGTGCCTCAGCCCGTTT
CATACGGATTAATTTATTGAAATATTGAGCTCTAATCACA
GCTGTTTCACCTACATGCCTAAAACTGTGTCAAAAAAGTG
TCAAAATGGCGGGTGTTCATTAAAGTCACATTTTGCTCTT
TTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations