Transcript

lrig1-003

ID
ZDB-TSCRIPT-141209-2041
Name
lrig1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060961 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060961|OTTDARG00000042254|ZDB-GENE-031113-23 lrig1|no_translation LRIG1-003 LG_none CR854847.7,CR339047.8 Danio rerio protein_coding KNOWN, 775 bp
CCCATACAGACCCCCTTTTCAACCTTTTAAGGACAACTGC
ATTTAGTTTTGGCTACTGGACAAGTTTCTTGTATTGCCTC
GTCGTGATTCACCTTTGATTTACTTACGTGGTGCTGCAGA
GGAGATTTTTTTTCAAACTGTGGGACTGTTTTCAAGTTCA
GGGCAGATGCATTGCCCGAAAGCAACGCAGTATAATTTGA
TAGTACCGCTGGGTAAACAAACAACTTAATGAAGGCGAAT
TACTCGAACTCTGAGAAACTCAATAAGCTCGAGCTGTCCG
TTTGTGGATGAGAGAGATCAGTCGTTAAGCGCTGAGACAA
CTGGATACAAAATGGCGGCGTGGCTGGGACAGATGGGATC
ACTTTCATATCATGTGTTTTATTGGCTTTTGACGCTGGAA
CTGTTAATCAATTATGGCGCACCGTGTCCTCAAAACTGTA
CGTGTACGCTTGATACGACCGACTGCAGTCGTTTGGACAT
GACTGATGTCCCTCAAGACTTGCCAAAGAGCACTGTGCAT
CTAAATCTGAGCCACAACAAGCTGACGGCAGTCGATATGG
ACATCCTCTCCAATCTGCCCCACCTGAGAGAAGTGAGGCT
TGACCACAATGAGCTGACATCTATCCCTTCATTTGGAGAT
GCCGCAGCATCAGTTGTTACACTTCTCCTGTAAGTGAAAC
ATTGTATGCCTTGATGACTGCTGAAGCTGCACTTTCTATG
CATGACAAAAATGACTGTTTACATCATACGGGCAATCAGA
AAAAAAGAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations