Transcript

si:ch1073-205c8.4-006

ID
ZDB-TSCRIPT-141209-428
Name
si:ch1073-205c8.4-006
Previous Names
  • ch1073-205c8.4-006
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053978|OTTDARG00000037721|ZDB-GENE-141219-17 si:ch1073-205c8.4|no_translation CH1073-205C8.4-006 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 548 bp
CTGACTCACACACACCGGCTCCCTCTACAGCTGCTGTGAA
ACACACTCACACACACACACACACACACTCTCTCTCCCTC
AGAGCGCAGCTCCCGAACACACCGCGCTGTTTGCTCTGCA
GAGGCCGAAGATGATCAAGCTTTTCTCGCTGAAGCAGCAG
AAGAAGGACGAGGAGTCAGCCGGCGGGCCGCGCGCGGGGG
GCGGCGGGAAGAAGGCGAGCGCGGCCCAGCTGCGGATACA
GAAGGACATCAATGAGCTGAACCTCCCGAAGACCTGCGAG
ATCGTCTTTCCAGACCAGGACGACCTGCTGAACTTTAAGC
TCATCATCTCTCCAGACGAGGGTTTCTATAAAGGAGGGAA
GTTCGTCTTCAGTTTTAAGGTGAGCAGCAGAGGGGCGAGC
GGCGCGTCCGTGTCCAGCTCTCTCCAGTGTGCTGTCGCCG
CTGCACTCACACTGTTCTGCTTGTTTCTGTAGTGTTCTGA
TCTGTATGTGAGTGATGTTGTGAAACTTCCGTGCGCTGAT
CTCTGCCGTTGTGGGAAGGTTTTTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations