Transcript

ube2m-203

ID
ZDB-TSCRIPT-141209-427
Name
ube2m-203
Previous Names
  • ch1073-205c8.4-008
  • si:ch1073-205c8.4-008
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053975 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053975|OTTDARG00000037721|ZDB-GENE-141219-17 si:ch1073-205c8.4|OTTDARP00000042411 CH1073-205C8.4-008 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 863 bp
CACACACACTCTCTCTCCCTCAGAGCGCAGCTCCCGAACA
CACCGCGCTGTTTGCTCTGCAGAGGCCGAAGATGATCAAG
CTTTTCTCGCTGAAGCAGCAGAAGAAGGACGAGGAGTCAG
CCGGCGGGCCGCGCGCGGGGGGCGGCGGGAAGAAGGCGAG
CGCGGCCCAGCTGCGGATACAGAAGGACATCAATGAGCTG
AACCTCCCGAAGACCTGCGAGATCGTCTTTCCAGACCAGG
ACGACCTGCTGAACTTTAAGCTCATCATCTCTCCAGACGA
GGGTTTCTATAAAGGAGGGAAGTTCGTCTTCAGTTTTAAG
GTAGGGCAGGGTTATCCGCACGACCCCCCCAAAGTCAAGT
GTGAAACGATGGTTTATCACCCCAACATTGACCTGGAGGG
AAACGTCTGTCTAAATATACTGAGACTGGAAACCGGTGCT
GACCATTAACTCCATCATATACGGACTACAGTACCTGTTC
CTCGAGCCCAATCCTGAAGACCCGCTGAATAAAGAGGCAG
CAGAGGTTCTGCAGACGAACCGGCGACTCTTCGAGCAGAA
CGTCCAGCGGTCGCTGCGGGGCGGATACGTGGGCGCCACC
TACTTCGAGCGCTGCCTGAAATAGTCCCGCGCCCGCCGGC
CCTCACGTCCGAGAATGCATTTATCGTTTACATGCGCTGA
GATGTACTGACCGACACACTGACCGCTCTCGGGTGTGCGG
GACGGTGGCGAGCGTTCACAGGCTGGTCAGTGGTTGTTGC
TCAGAGAATTCAGTCGTATTTCGCCACTATGCTGGTACCC
ACTGTTTATTTTTTGCTGAGATTCACATGCTAACTCATCC
TCCACTCAACATGAGCGTGCGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations