ZFIN ID: ZDB-TSCRIPT-141209-427
Transcript Name: ube2m-203
Previous Names: ch1073-205c8.4-008, si:ch1073-205c8.4-008

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053975 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053975|OTTDARG00000037721|ZDB-GENE-141219-17 si:ch1073-205c8.4|OTTDARP00000042411 CH1073-205C8.4-008 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 863 bp
CACACACACTCTCTCTCCCTCAGAGCGCAGCTCCCGAACA
CACCGCGCTGTTTGCTCTGCAGAGGCCGAAGATGATCAAG
CTTTTCTCGCTGAAGCAGCAGAAGAAGGACGAGGAGTCAG
CCGGCGGGCCGCGCGCGGGGGGCGGCGGGAAGAAGGCGAG
CGCGGCCCAGCTGCGGATACAGAAGGACATCAATGAGCTG
AACCTCCCGAAGACCTGCGAGATCGTCTTTCCAGACCAGG
ACGACCTGCTGAACTTTAAGCTCATCATCTCTCCAGACGA
GGGTTTCTATAAAGGAGGGAAGTTCGTCTTCAGTTTTAAG
GTAGGGCAGGGTTATCCGCACGACCCCCCCAAAGTCAAGT
GTGAAACGATGGTTTATCACCCCAACATTGACCTGGAGGG
AAACGTCTGTCTAAATATACTGAGACTGGAAACCGGTGCT
GACCATTAACTCCATCATATACGGACTACAGTACCTGTTC
CTCGAGCCCAATCCTGAAGACCCGCTGAATAAAGAGGCAG
CAGAGGTTCTGCAGACGAACCGGCGACTCTTCGAGCAGAA
CGTCCAGCGGTCGCTGCGGGGCGGATACGTGGGCGCCACC
TACTTCGAGCGCTGCCTGAAATAGTCCCGCGCCCGCCGGC
CCTCACGTCCGAGAATGCATTTATCGTTTACATGCGCTGA
GATGTACTGACCGACACACTGACCGCTCTCGGGTGTGCGG
GACGGTGGCGAGCGTTCACAGGCTGGTCAGTGGTTGTTGC
TCAGAGAATTCAGTCGTATTTCGCCACTATGCTGGTACCC
ACTGTTTATTTTTTGCTGAGATTCACATGCTAACTCATCC
TCCACTCAACATGAGCGTGCGCG

si:ch1073-205c8.4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:ch1073-205c8.4-006 (1) 548
si:ch1073-205c8.4-007 (1) 786
aberrant processed transcript ube2m-202 (1) 944
mRNA ube2m-203 863
ube2m-204 (1) 917
ube2m-205 (1) 1324
ube2m-206 (1) 1109
ube2m-207 (1) 770
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2m-203 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER ube2m-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053975 (1)
  • Ensembl_Trans:ENSDART00000161339 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD753278 (1) 953bp
    CITATIONS (2)