ZFIN ID: ZDB-TSCRIPT-141209-427
Transcript Name: ube2m-203
Previous Names: ch1073-205c8.4-008, si:ch1073-205c8.4-008

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053975 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053975|OTTDARG00000037721|ZDB-GENE-141219-17 si:ch1073-205c8.4|OTTDARP00000042411 CH1073-205C8.4-008 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 863 bp
CACACACACTCTCTCTCCCTCAGAGCGCAGCTCCCGAACA
CACCGCGCTGTTTGCTCTGCAGAGGCCGAAGATGATCAAG
CTTTTCTCGCTGAAGCAGCAGAAGAAGGACGAGGAGTCAG
CCGGCGGGCCGCGCGCGGGGGGCGGCGGGAAGAAGGCGAG
CGCGGCCCAGCTGCGGATACAGAAGGACATCAATGAGCTG
AACCTCCCGAAGACCTGCGAGATCGTCTTTCCAGACCAGG
ACGACCTGCTGAACTTTAAGCTCATCATCTCTCCAGACGA
GGGTTTCTATAAAGGAGGGAAGTTCGTCTTCAGTTTTAAG
GTAGGGCAGGGTTATCCGCACGACCCCCCCAAAGTCAAGT
GTGAAACGATGGTTTATCACCCCAACATTGACCTGGAGGG
AAACGTCTGTCTAAATATACTGAGACTGGAAACCGGTGCT
GACCATTAACTCCATCATATACGGACTACAGTACCTGTTC
CTCGAGCCCAATCCTGAAGACCCGCTGAATAAAGAGGCAG
CAGAGGTTCTGCAGACGAACCGGCGACTCTTCGAGCAGAA
CGTCCAGCGGTCGCTGCGGGGCGGATACGTGGGCGCCACC
TACTTCGAGCGCTGCCTGAAATAGTCCCGCGCCCGCCGGC
CCTCACGTCCGAGAATGCATTTATCGTTTACATGCGCTGA
GATGTACTGACCGACACACTGACCGCTCTCGGGTGTGCGG
GACGGTGGCGAGCGTTCACAGGCTGGTCAGTGGTTGTTGC
TCAGAGAATTCAGTCGTATTTCGCCACTATGCTGGTACCC
ACTGTTTATTTTTTGCTGAGATTCACATGCTAACTCATCC
TCCACTCAACATGAGCGTGCGCG

si:ch1073-205c8.4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript ube2m-202 (1)    Ensembl 944
mRNA ube2m-203 863
ube2m-204 (1)    Ensembl 917
ube2m-205 (1)    Ensembl 1324
ube2m-206 (1)    Ensembl 1109
ube2m-207 (1)    Ensembl 770
ncRNA si:ch1073-205c8.4-006 (1)    Ensembl 548
si:ch1073-205c8.4-007 (1)    Ensembl 786
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2m-203 Contained in:
[Fosmid] CH1073-205C8 (1)

Genome Resources: Vega_Trans:OTTDART00000053975 (1),  Ensembl_Trans:ENSDART00000161339 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD753278 (1) 953 nt
CITATIONS (2)