Transcript

ube2m-206

ID
ZDB-TSCRIPT-141209-1652
Name
ube2m-206
Previous Names
  • ch1073-205c8.4-002
  • si:ch1073-205c8.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053976 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053976|OTTDARG00000037721|ZDB-GENE-141219-17 si:ch1073-205c8.4|OTTDARP00000042412 CH1073-205C8.4-002 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 1109 bp
GGTGCCCTACCCAAAACATCCGCTTTCAGTATCACCGCAG
ATTTATGATAAAACTGACACAATTATATAATAGCTGTTAT
TAAAAAAACATTCATCTTGACAACAACAACACTATCAACA
ATAAGAAGATTTATTAACTTTAAAGTATAAGTTTGCGGTT
TCTGTCTAGTTAATTGTGTTCTGAAATCAGCTGAAAGAAC
AGTGTGTGAACAGAGCTAGCATTTGCGGCTAACACACACA
CTCACACAGGGAGAGAGAGAGAGAGAGAGAGAGACTGACT
CACACACACCGGCTCCCTCTACAGCTGCTGTGAAACACAC
TCACACACACACACACACACACTCTCTCTCCCTCAGAGCG
CAGCTCCCGAACACACCGCGCTGTTTGCTCTGCAGAGGCC
GAAGATGATCAAGCTTTTCTCGCTGAAGCAGCAGAAGAAG
GACGAGGAGTCAGCCGGCGGGCCGCGCGCGGGGGGCGGCG
GGAAGAAGGCGAGCGCGGCCCAGCTGCGGATACAGAAGGA
CATCAATGAGCTGAACCTCCCGAAGACCTGCGAGATCGTC
TTTCCAGACCAGGACGACCTGCTGAACTTTAAGCTCATCA
TCTCTCCAGACGAGGTAGGGCAGGGTTATCCGCACGACCC
CCCCAAAGTCAAGTGTGAAACGATGGTTTATCACCCCAAC
ATTGACCTGGAGGGAAACGTCTGTCTAAATATACTGAGAG
AAGACTGGAAACCGGTGCTGACCATTAACTCCATCATATA
CGGACTACAGTACCTGTTCCTCGAGCCCAATCCTGAAGAC
CCGCTGAATAAAGAGGCAGCAGAGGTTCTGCAGACGAACC
GGCGACTCTTCGAGCAGAACGTCCAGCGGTCGCTGCGGGG
CGGATACGTGGGCGCCACCTACTTCGAGCGCTGCCTGAAA
TAGTCCCGCGCCCGCCGGCCCTCACGTCCGAGAATGCATT
TATCGTTTACATGCGCTGAGATGTACTGACCGACACACTG
ACCGCTCTCGGGTGTGCGGGACGGTGGCGAGCGTTCACAG
GCTGGTCAGTGGTTGTTGCTCAGAGAATTCAGTCGTATTT
CGCCACTATGCTGGTACCCACTGTTTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations