Transcript

mcm7-202

ID
ZDB-TSCRIPT-141209-3646
Name
mcm7-202
Previous Names
  • ottdart00000062230
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062230 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062230|OTTDARG00000043017|ZDB-GENE-020419-27 mcm7|OTTDARP00000048624 mcm7-002 LG_1 CABZ01072633.1,CABZ01072634.1,CABZ01072635.1 Danio rerio protein_coding KNOWN, 441 bp
CACGCGCTTGTTATCCGTTAGCAATAAGAGCAGATCTGTG
CCGGGGTGTTCTCGCCTGCACGCGGGTGGCCGGTGCTGTA
ATGCGGTGGTGAAGGACGCGCTGGACGTCTACATCGAGCA
CCGGCTGATGATGGAGGTCAGAGGTCGCGACCCAGCAGAC
ACACGTGACCACAGGAAGCAGTACCCGCCCGAGCTGATGC
GCAGATTTGAGGTGTATTTCCGTCCTCCGGCGACGCTGAA
GCCGCGGGTTGTGCGTGATGTGAAGGCGGACAGCATCGGG
CAGCTGGTGACGGTCCGGGGAATCGTGACGCGAGCGACTG
AAGTCAAGCCCATGATGGCCGTCGCTACGTACACCTGCGA
CCAGTGCGGCGCCGAGACCTACCAGCCGATCGCCTCGCCC
AGCTTCACGCCGCTCATCATGTGCCCCAGTCAGGAGTGCG
T

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations