Transcript

mcm7-204

ID
ZDB-TSCRIPT-141209-1203
Name
mcm7-204
Previous Names
  • ottdart00000062231
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062231 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062231|OTTDARG00000043017|ZDB-GENE-020419-27 mcm7|OTTDARP00000048625 mcm7-003 LG_1 CABZ01072633.1,CABZ01072634.1,CABZ01072635.1 Danio rerio protein_coding KNOWN, 651 bp
ATCGATGGCGTTACACGCGCGTCACGATCAACGAAAGGTA
AAATCGAGGCCAGTGTCGCCTGTCGGACCGGGACACGGAC
TGCAGAGACGCGATCCGGTTTATCGACATGTTTATCTGAA
CTGAAGTGTTTTATTCGACGCGAGGCTGTTAGACGCGTCG
AAGCTTCGTCAGGCGTTTGTTCATCCGCTTATAATGAGCG
CGTGAATGTGTGTAAACGCGGATAAAGCGGCGTTTCTGCT
CCGGGTTTCGAGGATTTTTGCTTTCATTAGTTTGTTTACG
AACACGATCAGTATCACGTGACTACTGTTTATCAGCGGGC
CCGCGCCTCTGCAACTTTTCTCAAACACACACCACATAAC
CCTAACTAACAATACTGAACGGCGGTGGTGAAGGACGCGC
TGGACGTCTACATCGAGCACCGGCTGATGATGGAGGTCAG
AGGTCGCGACCCAGCAGACACACGTGACCACAGGAAGCAG
TACCCGCCCGAGCTGATGCGCAGATTTGAGGTGTATTTCC
GTCCTCCGGCGACGCTGAAGCCGCGGGTTGTGCGTGATGT
GAAGGCGGACAGCATCGGGCAGCTGGTGACGGTCCGGGGA
ATCGTGACGCGAGCGACTGAAGTCAAGCCCATGATGGCCG
TCGCTACGTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations