Transcript

mcm7-203

ID
ZDB-TSCRIPT-141209-2427
Name
mcm7-203
Previous Names
  • ottdart00000062232
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062232 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062232|OTTDARG00000043017|ZDB-GENE-020419-27 mcm7|OTTDARP00000048626 mcm7-004 LG_1 CABZ01072633.1,CABZ01072634.1,CABZ01072635.1 Danio rerio protein_coding KNOWN, 392 bp
GATGGCGTTACACGCGCGTCACGATCAACGAAAGGCGGTG
GTGAAGGACGCGCTGGACGTCTACATCGAGCACCGGCTGA
TGATGGAGGTCAGAGGTCGCGACCCAGCAGACACACGTGA
CCACAGGAAGCAGTACCCGCCCGAGCTGATGCGCAGATTT
GAGGTGTATTTCCGTCCTCCGGCGACGCTGAAGCCGCGGG
TTGTGCGTGATGTGAAGGCGGACAGCATCGGGCAGCTGGT
GACGGTCCGGGGAATCGTGACGCGAGCGACTGAAGTCAAG
CCCATGATGGCCGTCGCTACGTACACCTGCGACCAGTGCG
GCGCCGAGACCTACCAGCCGATCGCCTCGCCCAGCTTCAC
GCCGCTCATCATGTGCCCCAGTCAGGAGTGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations