ZFIN ID: ZDB-TSCRIPT-141209-3117
Transcript Name: elp1-202
Previous Names: dkey-124p11.3-004, ikbkap-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060468 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060468|OTTDARG00000041926|ZDB-GENE-071116-7 ikbkap|OTTDARP00000046731 DKEY-124P11.3-004 LG_ FP103010.12 Danio rerio protein_coding NOVEL, 547 bp
AACATTGAGATTTTCCTGAAACAGATCGACTCCATCAACC
ACATCAACCTCTTCCTCACTGAACTCAAAGAGGAAGACAC
CACCACAACGATGTACCCTTGTCCTTCACACTCAGCCGTA
GGAAAAGAAGGGAAAAAGGTGGACGTCGTCTGTGATGCTT
TACGCTCCACAATGGAGACTCTCGACCCACAGAAATATTG
TTTATGTATTCTGACATCTCATGTGAGAAAAACTACACCT
GAGCTGGAAACCGCTCTACAGAAAGTCCACGAGTTGAGAG
TGAACCCACCCGGCGGCACCAGCAGTGTGAGCGCAGAGGA
AGCCCTGAAGTATCTCCTGTTCCTGGTCAACGTGAACGAG
CTGTATGAACACTCACTCGGCACCTATGACTTTGACCTAG
TGCTCATGGTGGCTGAAAAATCGCAAAAGCCTTTGTCTCG
TTCACGTAGGACCCTAAAGAATACCTGCCCTTTCTGAACA
TGCTGAAAACCCTGGAGCCAAACTACCAGCGCTACACCAT
CGATAAACACCTCAAGAGATACAGGAA

elp1 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript elp1-202 547
mRNA elp1-204 (1) 4151
ncRNA ikbkap-002 (1) 714
ikbkap-003 (1) 904
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
elp1-202 Contained in:
OTHER elp1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060468 (1)
  • Ensembl_Trans:ENSDART00000165636 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI657563 (1) 547bp
    CITATIONS (2)