ZFIN ID: ZDB-TSCRIPT-141209-3107
Transcript Name: elp1-204
Previous Names: dkey-124p11.3-001, ikbkap-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060438 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060438|OTTDARG00000041926|ZDB-GENE-071116-7 ikbkap|OTTDARP00000046707 DKEY-124P11.3-001 LG_ FP103010.12 Danio rerio protein_coding NOVEL, 4151 bp
ACTGAAAACAACGTGTGAGTGTGTTGTGTTGTGTTGTGAA
TGTACGCCGCGCAAATGATCGTTTTCATCTTTAAGAAGGT
ATAAAATAAACAAGATCTCATCTTGAGGAAAACATAAACC
CACAATGAGAAACCTCAGTCTGCTGAAGCGCTTCAGAAGT
GTGGATCTTCCCATTCCAGGATCTCCTCAGTGTTTCTCTA
TCAGGAGTGAGGCTGGAACAGTGCTAGTGGCCTCAGAGTT
TGCCATCACAGAGTACAACCCTCAAACCGGAGAGGTTCTC
AATGAGGTTTCACTGACGGCAGATGACTATCTCCCAGAAG
ATGGTAGTGGCATTGTGCTGGCAATACAAGATCTGCCAGA
TCAGGAGTCGGTTTGTTTGGCCACTGCCAACGGGGATGTC
ATTCTCTACAACCTCAACACCAGTCAGTTGGAGTGTGTTG
GCAGTGTTGATAGCGGTCTGACCGGCATGACTTGGAGCCC
AGACCAAGAGCTGGTGACTCTGACCACAGGCCAGGAGAGC
ATTATCATGATGACCAAGGACTTTGAGCCGATAACGGAAG
TTGCAATCAATCAGGATGACTTTGGTGAAGATAAGTTCAT
CACAGTCGGTTGGGGGAAGAAGGAGACTCAGTTTCATGGT
TCTGAGGGCAAGCAGGCCGCCCAGCGGAAAGCAGCAGAAG
TACAGCCTGCCTTGCCATGGGATGACAGGAAGCCAAGGAT
TACTTGGCGAGGTGATGGGCAGTTCTTTGCTGTCAGTGCT
GTTTGTCCTCAGACTGGTGCTCGAAAGGTTCGCATCTGGA
ATCGAGAATGTGTCCTGCAGACCACCAGCGAGGTTGTCAA
TGGTCTGGAACAGTCTCTCTGCTGGAAGCCCACTGGCAGC
CTGATTGCGTCCACACAGCGGCACCCAAACAAACACACCG
TTGTGTTTATGGAGAAGAACGGACTGTTGCATGGAGATTT
TACTCTGCCTTTTGAAAAAGATCAGGTTAAGGTGAAGGAG
CTGCTGTGGAATAGTGACTCTACTGTTCTGGCGGTTTGGG
CTGAAGACTTGAAGCCCAAAAAGAATGATCATCCCAATAC
ATACATTCAGCTGTGGACCGTCAGCAATTATCACTGGTAT
CTAAAACAGAGTTTGCATTTTGGCAAAGATCCCATCAAAG
CTCCAGCATGTGTGTGCTGGGATCCAGAGAAAGCCTTGCG
ACTCCACATTCTGACTTCAGGATTGGTCAGCTGCACCTAT
GACTGGGGCTGGAGCACTCAGCGCAGTCACGGCTTGGATT
GCCATGACAACGCCAATGTGGCAGTGATTGATGGAGATAA
AGTTCTGGTGACGACGTTCCGCCAGTGTGTGATTCCTCCG
CCTATGTGTGCATTTGAGCTTCAACTTCCTGTTCCTGTCA
ACTTGGTCACGTTTCATTCTCAAGCCCAGAGAACCAATGA
GCTTGCAGCTCTCACAGCCGATGGGCAAGTTCATGTGTAC
AGTGAAGGTGGTGGAACTGAAAACAAAGCTGCATCTGCAT
TTAAAGTGGTCTCTGCGCCATTGGTTTTAAAAAAGACTTA
CAGGGTAAATGTGGATCAGGAGGAACCTCTAACCCTGCGT
TTACTCCTGTGGTTGAGTGAGGATATGTTTTTGGCTGTGG
CCCACGGAAGAAGCATGACACGCCTGCTGAAACTCACCCC
TTCTGACAACCAGGACCGCAAGGACATGATGGAGATCGGG
TCAGACATTGAAGTGGATGGTCATGTGATCAGCTTATGTC
ACAGTCTTAAAAATGGCACCGTGGCCCTGCAACTTGAAGA
TGGACAGATTCAGAAACTTCTCATGGACTCTTCAGGGCCA
AGTGTAACAGAATGGAAGGATTCCACTGGCAATACCATCA
ACTTTCCCCAGCCTTGTGTTCAGATGGCACTGTGTACTCT
CAGCGAAGAGGAATATTTCATTGGCCTCACAGAGAGATCT
CACCTCTTCATTGGGGACTCATTGGTGGCCTCCAATATCT
CCTCGTTTGTGGTTTATGACGAATTCCTGCTGCTCACCAC
ACACTCTCACATGTGCCACTGTCTCAGGCTCAGCATGCTC
TCTGTTAAAGGTATACAGTCAGCCCTAAGTTCAGACGCTA
ATCAGAACGATGAAACTGTCCGAAAGGTGGAGCGAGGCTC
TCGTATAGTGACCGTGGTTCCCCAGGACACAAGACTCATC
CTCCAGATGCCACGAGGGAATCTGGAAACCATCCATCATC
GAGCTCTTGTACTTGCTCAGCTCAGAAAGTGGCTTGATGG
CCTCAGATTTAGAGATGCTTTCGAGTGCATGAGGAAGCTG
AGAATTAACCTCAACCTCATCTATGACCACAATCCCACTG
TGTTTCTTGACAACATTGAGATTTTCCTGAAACAGATCGA
CTCCATCAACCACATCAACCTCTTCCTCACTGAACTCAAA
GAGGAAGACACCACCACAACGATGTACCCTTGTCCTTCAC
ACTCAGCCGTAGGAAAAGAAGGGAAAAAGGTGGACGTCGT
CTGTGATGCTTTACGCTCCACAATGGAGACTCTCGACCCA
CAGAAATATTGTTTATGTATTCTGACATCTCATGTGAGAA
AAACTACACCTGAGCTGGAAACCGCTCTACAGAAAGTCCA
CGAGTTGAGAGTGAACCCACCCGGCGGCACCAGCAGTGTG
AGCGCAGAGGAAGCCCTGAAGTATCTCCTGTTCCTGGTCA
ACGTGAACGAGCTGTATGAACACTCACTCGGCACCTATGA
CTTTGACCTAGTGCTCATGGTGGCTGAAAAATCGCAAAAG
GACCCTAAAGAATACCTGCCCTTTCTGAACATGCTGAAAA
CCCTGGAGCCAAACTACCAGCGCTACACCATCGATAAACA
CCTCAAGAGATACAGGAAGGCCTTGCATCACCTCAGCAAG
TGCGGTGAAGAGCACTTCACGGAGATGCTTAACTTGGTGA
AGGATCAGAGACTGTACAGTGATGCTCTTGAGCTGTATCC
GTCAGGCAGTCAGCAATATAAGACCCTGAGTGTGGCCTAT
GCAGAGTATCTGGTGGAGCAGCAGCAGGCCGAGCAGGCGG
GACTGCTGTTGTGGAGGTGTGGAGAGTCTACTCGTGCCCT
GCAGGCCTTCGTCAGCTGCACCAGCTGGAGAAACGCACTT
GCCGTGGCTGCGCAAATCCCATTACCACCACAGCAACTGG
CACTGCTGGCACGAGATCTGGCAGAGAAACTTCTGGAGGC
CAGAAGACACACAGAAGCTGCTCTGTGTTTGGAGCAGTAT
GCTAAGGATTGTGAGGAGGCAATTTCTGCTCTGATACAAG
GAGCTGCATGGGAAGAAGCGCTGAGATTGATTTATTTGTA
CAACAGACAGGACATCATTGAGACTGATTTGAAGCCGGCT
CTTTTAGAAGCTCACAGTAATCAGACGTCCTTCCTGGAGT
CCCAGAAGGCTTTGTTCATCCGTCACAAAAACCGCCTCTC
TGTGGTTCGAGAACTCAAAGCCAAAGCCAGCCTTGAGTTA
TTTGGTGAGGACGGCCCTGACTGTGCAGATGCTGAACTCT
ATTCAGAGGCCAGCAGTGTCATGACCGGCAGCCATCTTGG
CTCAAAATACTCCCGCAGCAACTCTCGCATTTCATCGCGT
TCGTCTAAAAATCGGAGGAAGGCAGAGGGGAAAAAACACA
GTCTCAAGGAGGGAAGCCCATTCGAGGACATCGCCCTCCT
GAACGCTCTTACTCAAATCATCACTGTTGTTGATAAAATG
AGGGAAGAAGTTCACAGTCTGCTGAAGGCTCTGGTGCTCT
TCCAGTTCGACGATGCGGCCAGCGCTCTGCAGAGAGACTA
CAGTGATCTGCTTCTGCTCATGGACAAATCTATTCCTGAC
ATCTGGAGCGAGAACCTGCAGCCGGGCCAAAATACACTCA
CAGGTCCGAACTCGACAGTGAACAGTATCGTAGCATCATT
TCAGCAGCAGAAACCGGCTGTGCCTCAACAAGACACAGAA
GCGCTGGCGCCTCCAAAGATGAGGAATTCTGTCAAGTGGA
AACTCAACATTCTCAAGTAGTTTGCATGTCACACTTTTTT
ATTGTATTTAATTTGAATACGAGCGCCGTTTTATTGAATT
ATTATGGTTGAATTAAAGATTATAAAAGATT

elp1 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript elp1-202 (1) 547
mRNA elp1-204 4151
ncRNA ikbkap-002 (1) 714
ikbkap-003 (1) 904
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
elp1-204 Contained in:
OTHER elp1-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060438 (1)
  • Ensembl_Trans:ENSDART00000168174 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EG584727 (1) 917bp
    GenBank:EE684992 (1) 916bp
    GenBank:EE715887 (1) 911bp
    GenBank:EE330759 (1) 838bp
    GenBank:CN172112 (1) 798bp
    GenBank:CT731433 (1) 795bp
    GenBank:CT704972 (1) 776bp
    GenBank:CT640637 (1) 772bp
    GenBank:CT696202 (1) 764bp
    GenBank:CK237316 (1) 755bp
    GenBank:BI879503 (1) 693bp
    GenBank:CD594597 (1) 650bp
    GenBank:EB849657 (1) 564bp
    GenBank:EB932051 (1) 482bp
    GenBank:EB848069 (1) 479bp
    GenBank:AL717568 (1) 393bp
    GenBank:EB929795 (1) 389bp
    GenBank:EB773436 (1) 379bp
    CITATIONS (2)