ZFIN ID: ZDB-TSCRIPT-141209-1888
Transcript Name: ikbkap-003
Previous Name: dkey-124p11.3-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060440 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060440|OTTDARG00000041926|ZDB-GENE-071116-7 ikbkap|no_translation DKEY-124P11.3-003 LG_ FP103010.12 Danio rerio protein_coding NOVEL, 904 bp
TTTATTGTTTTCAGAGAAACTTCTGGAGGCCAGAAGACAC
ACAGAAGCTGCTCTGTGTTTGGAGCAGTATGCTAAGGATT
GTGAGGAGGCAATTTCTGCTCTGATACAAGGAGCTGCATG
GGAAGAAGCGCTGAGATTGATTTATTTGTACAACAGACAG
GACATCATTGAGACTGATTTGAAGCCGGCTCTTTTAGAAG
CTCACAGTAATCAGACGTCCTTCCTGGAGTCCCAGAAGGC
TTTGTTCATCCGTCACAAAAACCGCCTCTCTGTGGTTCGA
GAACTCAAAGCCAAAGCCAGCCTTGAGTTATTTGGTGAGG
ACGGCCCTGACTGTGCAGATGCTGAACTCTATTCAGAGGC
CAGCAGTGTCATGACCGGCAGCCATCTTGGCTCAAAATAC
TCCCGCAGCAACTCTCGCATTTCATCGCGTTCGTCTAAAA
ATCGGAGGAAGGCAGAGGGGAAAAAACACAGTCTCAAGGA
GGGAAGCCCATTCGAGGACATCGCCCTCCTGAACGCTCTT
ACTCAAATCATCACTGTTGTTGATAAAATGAGGGAAGAAG
TTCACAGTCTGCTGAAGGCTCTGGTGCTCTTCCAGTTCGA
CGATGCGGCCAGCGCTCTGCAGAGAGACTACAGTGATCTG
CTTCTGCTCATGGACAAATCTATTCCTGACATCTGGAGCG
AGAACCTGCAGCCGGGCCAAAATACACTCACAGGTCCGAA
CTCGACAGTGAACAGTATCGTAGCATCATTTCAGCAGCAG
AAACCGGCTGTGCCTCAACAAGACACAGAAGCGCTGGCGC
CTCCAAAGATGAGGAATTCTGTCAAGTGGAAACTCAACAT
TCTCAAGTAGTTTGCATGTCACACTTTTTTATTGTATTTA
ATTTGAATACGAGCGCCGTTTTAT

elp1 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript elp1-202 (1) 547
mRNA elp1-204 (1) 4151
ncRNA ikbkap-002 (1) 714
ikbkap-003 904
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ikbkap-003 Contained in:
OTHER ikbkap-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060440 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE313440 (1) 906bp
    CITATIONS (1)